Description :
From Genome Similarity Track
Location :
contig_2:71731- 76157
Transcript NameFunction/comments
g447.t1hypothetical protein
g448.t1hypothetical protein

Sequence
4426 bases(100 bases per row)
ATTTTACGTCTGTTGAGAAGAAGCACGAGTTGTTTGATCTGGCGCTGCGCTGCTAGCCGTCGACAGACGTGTGGTGTTATTAGTCATCGAGCTTAGAGCT
CGTGCAAGCCCATTCGTTATCTTTCTCCGCACACAACAAGTGGGCAGATATTATTTACCATCATGGAACCGCGCTGCCCGTTCAAAACCCCTCTCTCGCT
TTCGGAGCGTGATCGTCGGTCGATGCACAAACTGGCGCAGCGCTGCATCCACGAAACGCTGATGGACTATGAACATGTTCTAGCGAGCAAAAGCGGCCTA
CCCAGCGCCACCCGCTGGAAACCCATCAGGCGAAAGGAAAACGTCGTCGTGTACCAGGATCAACTTGCAGTCGAGGAGATCAAGCGTCAGAAACGAAAAG
CGAAATCGCTTGGAGATATCATCGAGTCGTCTCGTGTTGGTGACATTCTTTCGAGGAGCGTAGGTCCAGGGACATTTCGATCGTCCGCCACCGCATTCGC
CAGAGAGACCGAGGAGAACGACTCAAAGGAGCTGCCGAAGATGATCTGGATGGGTACCGTGGACTGCGATCTGGACGACCTCATGTACGGCCTCGTAAGC
CAGAGCGACGAGGTGACCCGCATCAAGTCTTCCTACTCCGGCAACGGCATTCAGGACTTTGCTACGCTCGCATCCCTGGAAACGTCAACACCTAGCGACC
CGTTCTACGGGCTACAGCTCAAGTGGGAGGTCAGTGGTTCCAAGGCAAATCCAATGTGGCGCTCCCGCGACTTCGTATACCTAGAGGCTACGGGTGTGAC
CAAGAGCCGTTCAACTGGCCAACGCATCGGGTACCAGATCCTGCACTCGCTGGATGTTCGTGGCGTGCCCGAACTGCCAGGACGCAAGTTGACTCGCGGC
AAGATGACAATCTACCAGTTGTTCCGTCAAAAGGCCAAGGGGACCGTCGAAGTATTCGCCAAGGCGATGGTGGACTTGGCCGGAGACGTGCCTGCTAGCA
TGGCCTCGTTCGCTACCATTAAGGCGGCCAGCACCGTCAACAAGGCAGCCAAGTGCGCTCGTAAACGCAAACTCAACTGGCTGTTGGCCACGGCTGAAGC
CAACTCAGTCAACTTTGGTGTTGGCAACAACGACTCATGCTGCAGTGTGTGCGCCCAGGGACTTCGGATGCCTTTGGGCAAAAGAGCTCCTTCGAGTGCC
GCATTTGCACCAAGCGTGTGCCACAGGTGCCACATCCGACAAAAGCTCAGCTTTGTCAAGCCTGACAAGGACTCGTTCGTCATCAAGCAGAAGGCGCTCG
AGCTGTGCACGCGATGTGTGCACACCGCCACGCAGATGAACGCTCGACGAGTGGCACTCGAAGAACGCGCACGGGAAGACCCCGCGTCCATGTATATCTA
CATTCCTCGCCAAAAGAAGTCGTCACTCGAGGAGAGCTCATGCCTCGAAGAGCTCGACCTCTCAAGGGTAACGGAGAACGACGTGGAGTTCCCTCCGACA
CCCAAGCCTGCTCTCTTTGATCGGGCAGCACAAGCGCTGTACTCATTCTTTTGAGTACAAGCCGCAATATCTAGAAATCCATCCGCTGTCTAGCGTCCTC
ATCCATCGGAAGATGAGAAAACATGTACTTGTAATACAAGTTGTAGCTTCCCGTAAATTATATAGTACTTCAGTGCCTTTCAGCGCACACTCCTTGTTCT
TCTTCAGTAACCTCCGCAGTAGTTCGCGCTCGACGGCATGAGCGCAGGCCCAACCGCAACTCGAGCTCGCTTCAAGGTGCTGTTCTTTTGGGCAGATCGA
TGGCCCTGCATCAAGACAGCAGTCTCTTTGCTCGCGACGGACTCGACGAAGTAAAGGTACGGCTCCGTCCCGGTTTCATCCAGTCCAAGCGTGCACGCGT
GCACGCGACGCGAGATGCCATTTCGTCGAAATCCAAGCAGGTCTGTGATGTGGCCGCCTTCCCTCACGCGAACGAGGGCACCGCCTGCAGATTCGTAGGC
GCCCATTTGCGGCACGCTGGCCCAGATGCAACCCTCGGCATCCAGACTGATCCCGCCGAGTAGCGAGCCCATTCGCCCAGACTCGACGATTAGCCAGCTT
GCCTTCCTCACCAACGTCGAAGGCAGTTAGTCGACCGGCCAGTGTTTCGCCCACGATCAGTGACTTGCCATCTGGAGTGATCACCATTCCGTTCGGCAGC
AGCAGGTCGGTGGCCTCCACGCGAACCTGTCTGTCCACGGGGTCGATGCTCACGAGCGTCGTCGAGCAGCAGCTCTTGATATTGGCGACGTCGAAGCCGG
CATTGCTCAGATACACCCGACCGGAGGCTGCGACGACCAGGTCGTTCGCTCGGAACTGCGTCACGCTCGACACGTCCGCGTACAGCTCGACGCAGCTGGA
TGTTTGGTCCAAGACCAGCACTTGTCGGTGCTTCATGCGTACAATGAGCATGCGGCCGTCGGGCAGCCACCCGATAGCCGACACGAAGTCCTCGATGTCC
TCGTACACGACCCCGACGTTTTCCGTGGCTAGGGAGTACCGCAGCACCTTCTTGCCAAACATGTCGACGAAGTACAGCGTCTGCTCTTGGCGTCGGAAGC
GCGGGCTGCTCCCGTGCATGAGGCCACTGACCAGCAGCGACGCCGCGCGCTCTTCGGTGCCGATTGGGTTCCTTGGGACCAAATGGAGTCGACGCATAGC
CCATTGCCACAGAAGCTTGCGAGGAAATACCAGCTTGAGCACGTTGGGTACCCGCCTCTTGAAGAGTTCGGGGGCGTCCTCCACCGCTTTCGTCGACGAG
ATGCAGCCCCAGTGGAAACACCATGGCGTAAAGGGACACTGTGGTGCGTTGCCGTGTGCAGCGCGAGGCAAGTCGGAAACTGAAGCGCTCGTCACGACAA
AGTCGATGGGGGGCGGATCATATACCACATCACAGCTTCCGAATCAGTGCGGGATCTTCCGTCCAGCGAGAGCTTGAGCGGAGACGCCACTAGACCATTA
ACCTTACAGAGAGAGCGGTGCTGTGCAGCAAGTGGGTCACGACAGCAATTGGCCATCCTCGGTTCATGCATGGAGGCAACCAACACTTGCTCTCTACGAC
ATCTGCTAGGCCTAGAGAGTATTGGCGTATCTTTCCTGTCTGGATATTGTAATCGTCATGTGCAGTTGAAGGCGAAATACCAACGGCAAGCGGTTGTTGT
CCGTGTCAAGCAGGGCCAGATGAAAAATAGTATGCAACTAGAAGCTAGAAATCGGGGGGGCATCATTATGATGAAGTGTTTTGGATGCGCGGAACGCGCA
GTCAGTTAGACCAGGACATCGGACGACGAAAAGAAACGCTGTATTCAGCCATGGCCCGGCAATTTACAATTGCTGGGCGGAACATGGAGAGCATGGAGGT
CAAGTCGATCGTCAAGAGTTCCGAACTCAAGCACATCCTATTAATGGAGCTTCTGGACTCCCACCTAGCAGTAGCATGCATTGCCAGGACCACCAGTTGC
GAGCTGCGGTCGTGGTGCACAGAACCAAGAAAGCAAATACTTTATTATACCTAGATACATTGTACGTTGCAGCGGTGTTCCTACGCCGCGACCACGCTCT
TGAGCGGCAGCACAGCGGCCAGCTCTTCGCAGTGGAGTTTGGCGTCGTCGTACCCCATGGCAAAACGCTCTTCGTGCGTGTTCAGGTCGACCGACAAATG
GAAGGATGCTACCGACTGCGAGCGCCAATTCCACGGCTTGATGATGAGCCGCTTCACTTGGTTGCTCGCGTCGGAAGCTGAAGACGGGGCGATGGCGTCG
TGCGGGCTCGTGAGCATCGGCATCGAGTTGAAGACCTTGTTGGCGGCGTTCTTCCCCCACGCCCCAGGAATGAGGTACCCAGCGAGCGCGGTGGAGGCTG
AGCGCGCGTAGTCCAGCACAGTCTGCGCCGTGTGGAAGGTCAGGTCGGCCCATGTCGAGTATTCGTCACAGTCGACCCCCTTAAAGTTGGTGAAGGCGCC
GTCGATGTACCACTGGCCGCGGTGCGAGATGCACGGCTTGCCCGAGAGCGCGAACGGCACGAGCGACGAGGCCATGATGGAGCCCGTGAGGTCGTCCAGA
CTCTCCCAGGACGTGTGCTTCTCCGCCTTCATGGACGGGAACTTGGTCACTGCGATGGTCAGGTGGTGCTGCTGCACGCGCTCGTGGATGTCCTCGTCGT
CTCGCCAGAGTTCGTGCAGCGTCTGCTTCACGATGGAGGCGTAGCGGCCGTAACCCGAATACCATTTCGGCGACGTGATGACTTTGGCTTGCGTCTCCTT
GATGACCCGCCAGGCCTCCAGCACCGGGGTCTCCGATGCCAGCAGCGCGGCGGCCCAAGAGCCCCCAGAGCAGCCGGAGAAGCGGCAATTGGATAGATCG
AAGGTGTCCTGCAGGTACGCAGCCAC