Description :
From Genome Similarity Track
Location :
Scaffold_768:7172- 8230
Transcript NameFunction/comments
g3002.t1hypothetical protein

Sequence
1058 bases(100 bases per row)
CGGACATGTGCCTCTACTACAAGCGCGACGGCAACGACATGACCATCGTGGGCTTGTACGTGGATGACCTGCTGGTCACCGCGTCCAAGCCGGACCTGAT
CGAGGATTTCTTTGTGGCCATGAAGATCCTGTCCATCAAGGATTTGGGCAAGGGGAGCAAGTTCATTGGGATGCGCGTGCATCTCGACGAGGCGGGCGGC
TACAACCTAGACCAACAAGCCGCCATTGAAGAGCTGCTGGTGCAGTTCGGTCTGGCGGATGCGAACGGCGTCAAGACGCCCATCGGCGAAGAGGCCAACG
ACGCTGAGCCCCAAGAGCTGCAGCTGCTGCAGGGCGTCGGCTCCAACGGCGAACCCACGATTCGGACCTTCCAGTCGCTGGTCGGCAGCTTGCTCTGGAT
CGCCCGGTGCACCAGGCCTGACATCAGCTTCGCGGTGCACAAGGCGACCAGGTACACGCACCAGCCGCGGACGAGCGACTGGAAGCTCGCGAAGAGGATC
GCACGGTACTTGAAGGCCACCAAGACCCTCAAGCTCCGCATGGACGTCGGCGTGGCCGACGGGCGCTGCATCCAGGTAGAGAGCTGGAGCGACGCGGACT
TCGCGGCCGACAAGGGCGACCGGAAGTCGGTGACCGGGGGCGTGGTCACCATGGATGGAGCGATCGTGCACTGGATCTGCAAGAAGCAGACGGGCGTGTC
GTTGGCAACGATGGAGGCCGAGTTCACGGCGGCCTCCCACGTCGGACGCGAGTTGCTCGGACTACGTGAGCTGGTGCGCGAGCTACACTTTGCCGTCTCT
CAGCCCATGCCCATGCACATGGACAACCAGGCCGCCATCAAGCAGCTGGAGTCCGAGGACAGCATGGTGAGCGCCAAGCACGTCGGCATCCGGATCAAGT
TCATCTGCGACTACGCGCGCAAGGGCATCGTGGAGCCCAAGTACGTCGAGTCGCATCTGATGAAGGCGGATCTGTTGACCAAGGCCTTCCCGGCGCCCAG
GATGGCGGAGTTGCGCCAAATCGTCAAGTTGACGTAGGTGACGGCCGAGGAGGAGTGT