Description :
From Genome Similarity Track
Location :
Scaffold_8:717178- 718240
Sequence
1062 bases(100 bases per row)
ATCGCGCCGAGGAAACAGCCACGCCAGCAGATTCCAGCGGTGATACCTACGGTTGAACAAGGCGAAGAACTGTTAGTCGCGAGTTTCGATGGATCAGCAC
GAGTCAAACCAGGCGGTTGAGCGTGTAGCGCTATCATCTGGAAGTTACCTGAATGGATCGTTGTCCCAGCCGAATCGAAGTACTTGCCCGACCTAACGGT
GAATGATGCGGAGTACCAGGGCCTGTTGTTGGGCTTCGATCTACTTTCCATCTTGGACCGGGGACGCCTGATCATCTGTGGGGACTCCAACTTGGTGATA
CGGCACATGCGAGGCGGGATAGAGTGCAAGGCACCAGGTCTGACCCCTCTTCGTTGCCGGGCATTAGATCGGCTGAGAACGTGGCCGGCCCACGAGTTCC
TGCACGTCAAGCGAGACTGGAACCAGAGCACAGACAGGTTAGCCAACACTGCATTACATCAGCAAGAAGGCACAATGGTTACCTCCGAAGCAGACCGCGA
CGACTTGGTTGTTCTCAACCGACTCCAGGAGCTCCTGCTCCCGAAGGACGAAGGATCTGTCGCCCGGATGGTCGCGACGACTCGATCGCGAACACGCTCG
AAGAACTCGGCGGAGGTGCTACAACTAGATGTGGTTCAACACATTAGGACGGATCGGATTCTGCGAGCACAAAACGAAGAAAAGTGGATCGTAAACCTCA
AGGCGTACCTGTCAGGCGACTTGGAGAGCCTAGATGCTGGCGAAGCGCGAGCCTGCGGTAAAATCGCGGGTGACTACGACGTGGACGATGGTGCGTTGCT
CCTCTACTGCCCTCGCGCAGGAAGAGACGACGGTGACCGCGATCGGCTGGCGAAGCTGGTGGTGCCAGAGGACCTGCAGCAAGATGTACTTCACCAATAT
CACACGAGTTTGGAAGGAGGACACCAAGGGGTCGGAAGAACGTACCAGCGGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGAATCC