Description :
From Genome Similarity Track
Location :
Scaffold_815:7171- 9295
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_815-fgenesh-gene-0.2Myosin

Sequence
2124 bases(100 bases per row)
ACGACAACCTCGGGCCCGAGGGGATCGACGACATGATCGAGCTCAACTACCTGCACGAGGCCGCGATCCTGTACAACGTGCGCCAGCGGTTCATGCGGCG
GCTGCCGTACACGTACACGGGCGAGATCTGCATCGCCGTGAACCCGTACCAGTGGCTGCCCGAGCTCTACTCGGAAGACATCCACCAGCAGTACCTGACG
CGGCCGCGAGAGGAGCTGCCTCCCCATGTGTACGCGACGTCGGTGGCGTCGTACAAGGACATGAAGCGGCGCGAGGTGAACCAGTCCATCCTCGTCAGCG
GCGAGTCGGGAGCGGGGAAGACGGAGACGACCAAGATCCTCATGAACCACCTGGCGTCCATCGCCGGCGGACTGAACGACTCGACCATCAAGAAGATCAT
TGAAGTGAACCCGCTGCTGGAGTCGTTCGGCAACGCCAAGACGGTCCGCAACGACAACAGTAGTCGCTTTGGCAAGTTCACGCAGCTGCAATTCGACAAC
GTTGGCATCCTCGTTGGTGCGCGGTGCCGGACGTACTTGCTGGAGAAGACGCGGGTCATCTCCCACGAAGCGCCAGAGCGGAACTACCACATCTTCTACC
AGTTGATTGAGTCGACGAACCACAAGGAGTGGCAGCTCGACCCGAGCAAGACGTACGCGTATACTGGGGAGAACACAGCCACGAAGATCGAAGGGATGTC
GGACGCGAAGCATTTCGAACGCACGCAGAAGGCTCTGTCGCTTGTGGGAATCTCGGACCAAGACCAGCGAGTGCTGTTTGATGCCTTGGCGGGTATCCTG
CATCTTGGCGAAGTGGTCGTGACGTCAAAGCCCACGAACGAGGAAGAAGCGTCGATCGCCCCCAGTAATCCCGGCGCTGTCGTTGCCGCTGAGTTGTTCG
GTATTACCATCGATGACCTTTGCAAGGTTCTTTGTTCGCGAGTGATGACTGTCGGCGCCGAGAAGCTGACAGTCTTTTTGCGGAAAGACCAAGCCGAGGA
GTGTCGTGACGCGCTGTCGAAGGCAGTGTACGCGAAGCTGTTCGACTGGCTGGTGAAGCAGATCAACACGTCGCTCGAGAACGACAAGAAGATGCAGCAC
CACATCGGGATCCTCGATATCTTTGGGTTCGAGCACTTCAAGCACAATTCGTTCGAGCAGTTCTGCATCAACTATGCGAACGAGAAGCTGCAGCAGAAGT
TCACGCAGGATGTCTTCAAAACCGTCCAGCAGGAGTACGAAGCCGAGGGGATCATCTGGAGCCACATTGAGTTCGCAGACAACCAAGACGTCATTTCGTT
GGTTGAGGATCGACTGGGCATCATCTCTCTGCTGAACGATGAGGTGATGCGTCCGAAGGGAAATGACGAATCGCTTGTGTCCAAGTTGACTTCGATCCAC
AAGGAGGACAAGCATGTCGTCGAGTTTCCGAGGACCTCGCGAACTCAGTTTACGATCAAGCACTATGCCGGTGCAGTGACGTACGAAGCGACCGGGTTTC
TGGAAAAGCACAAGGACGCGTTGCTTCCTGACTTGTCGGATCTGATGCGTCGGTCGTCTAAGCCGTTTGTGGCGGCGCTGTTCGAGCCTCCCGCTGCCTC
CGCGACTGGCGGTGGATACACCGGCGGTCGTGGTCGTGGTGGAGGAAGCGCATTCGCTGTTGCGAACGTTGGTACGCAGTTCAAAGACAATTTGAACGAG
CTGATGACGAATATCCGTCAGACGAAGGTCCATTATGTGCGCTGCATCAAGCCGAACCGCGAGAAGCGCTCTGACGACATGGAGAACCACATGGTGGTGT
CCCAACTGCGGTGTGCTGGCGTGATTGAGGCGATTCGTATCTCGCGGGTTGCGTATCCGAACCGGCTTCTGTTGGACGATTTGCTGGACAAATTTTGGGT
GTTCGACTTGGATCGTAAGAAAAAGGACGTTGCGGCGAAGGACCGATGTCTCGCGCTCATGGGTCGGATGGAGTTTTCGTCTCCAGACCAGTATCAGATT
GGTTTGACGCGGGTATATTTCCGTTTCGGGATCCTCGAAGAGATGGAAGACAAGCGCAAGCAACACTTGGACTCCCAGGCTCGCCGTCTCCAGCACATCA
TGCGGGGTTTCCACTGTCGTTTGC