Description :
From Genome Similarity Track
Location :
Scaffold_11:71707- 73684
Transcript NameFunction/comments
Sapdi_VS20SDRG_04414hypothetical protein

Sequence
1977 bases(100 bases per row)
ACAGAGACAAATGGTTCTTGTTTTGCCCAACGTATAGCAAGGCCCAAAGAGATGACCGCTTCGGCGTGAAGTTCTTTCAAGTCACAACGCGCCGTTTCCT
GTACATTCCACACTAACGTTACCGGTAAATGAATGAGGTCAGACAAACCAAAAGGTTACCACCGTTTTCAGCGCTTTTCATTGGTCACTTCCCATTGATC
AAATAAACAAGTTAATGCGCTTTGGAACGTTGGACGCGGACAAAAGGTCACAGATTAGTCAGCTATCGACGAATATCCCTGCCGTGACGACCTTTGACAC
CAAATTTGCACTGGAATCAGGACGTTTCTGTCGATAAGAACTCAAGTTGTCGGACCCTTGAAAATCTGGTGTCGATGTTATAGGTACACGGTGTCGCTAC
AGTAGCACCGCCGAGGTAGGTACAGCAGTGTTGCGGCACGTATGGTATGCGAACTGCGTTGATATTTTGCGGTGGTTGTTCAGAATTGGGTTCTGGCTTC
GCCGCAGGAAGATGGGATAAATACGCCACAGTTTTCCATAACAAAGCACCCATTTCGAAAATGACCGAGCGCTACACCACCGTCGAGACGCCAAAAGCAG
GCGCTCGCAGCGCCAACCCACAAGAGAGCGCTTCGTGGACCTCGACGCTCACCATGTCGTGGATGAACGACCTCATGCAACGAGGCGCGACGACGCCACT
CAACGACGACGATACGTGGCCATTGGCTGCGAAAGACTCGGCCAGCGCTCTCCACGACCGCTTTGATTTGCACTGGCGAACCGAGAAGACAATGGAACAA
CCTCGCTTTCAGCGCGCGCTGTTGTATACCTTCCGTTACCAAATCGCTTGCGACGTCGGCCTCTATTGTGTCTATGCCGGTGCGATGCTCGTCCAACCCG
GCTTGATTCGCTCGATTTTGAAGGACCTCGCAACCGACGCCAACGACGATGATGGCTACGCGCTCGCAGCGCTCCTTGCGGTCGTCTCGTTCCTTGCGGT
CACTGTCTTTGACTTTGCACAGTACTTGAGCACGCACACGGGCTGCAACGCCAAGTCGCTCGTCATCGACGCGGTGTTTCGCAAGACTCTCACGCTTTCC
GGCTTTGCCAAGCAAGACATGTCGACCGGTGACATTGTCACGTTGGCGTCCGTCGACGCGGACCGTATCTACATGGGTTTCATCTTTGGCCATTGGATCC
TCATCGCCCCGTTGATGCTCCTCGCCGTGTACGTCATGATTGGAGTCGAACTCGGAGCGCTCGTTGGTCTCGCGGGTGGGGCGACGATGCTGCTCTTCGT
TGTCATCGGCACCGACTCGGGGCGCAAGGCCGGTGAGATCCATCGCAACCTCCTTAGCGTTCAAGCGCACCGCGTCAAGCTCACGAATGAAGTGCTCCAA
GGCATCCGTGTCGTCAAGCTCAACGCATGGGAAGATCACCTTGAAGTGCAGCTGGAAGCTGTCCGCGACCAAGAGCTCGTGCTTCTCAAAGCGTACCAGG
TTCGCTCCACCGCCAACACGGTCGCGCTCTACATCGCGCCCGTCATTTCACTCGCGGTTTGTCTCTTCGTGTACGTTGCGGTGGGCAACGAGCTCACGGC
GCCTGTCGCGTTCACCGCGCTCGCCTACGCCAACGTGACGCGGCTCCCATGTACTGTCTTCGCGACGGCGGTCATGTTCACATCTGAAATGGTCGCGTCG
TGTGAGCGCCTCGGTGCCTTCTTGACGTCCGACGAAGTCACGACAACTTGTACACAGGATTCAAGTCGGCATTTGTATCTCATCACCGTTATATGACTAG
GTACGGCGACGACCCAAGGCGCATCCAGCGTGCAGTTGAGCGACGCAGCGTTCAGCTGGGCAGCGCCGGCCTCGGGCATTGACTCACCACCGCGCACGCT
GCGCAATCTCTCGTTCACTTTGGCACCCGGCAGCCTCACGATCGTCGTTGGTCCCGTCGGCAGCGGCAAGTCGAGCC