Description :
From Genome Similarity Track
Location :
Scaffold_182:7170- 16137
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19759hypothetical protein
Phypa_INRA-310PPTG_19760hypothetical protein
Phypa_INRA-310PPTG_19761hypothetical protein
Phypa_INRA-310PPTG_19762hypothetical protein

Sequence
8967 bases(100 bases per row)
GTCCTTCGAGCTCACCAAATACTTTTCGTTTACGATCACGTATCCTGCGCAATAGACTCCGTCTGCCGACGCAAACTTCATGCCTTTGAAGAAAACGTAA
TTGTTGTAGTCAGAAACGAGACCGAAACGTGTCTGAAGCATGGCGCCAGTCGAGATCTCGAAGTTGGTGGCTGTTCCCCCCTGCGCAGCCCTCTCGTTTG
CGGACGTGTCTGTGCTCACACTCGACCTCTGGTGAATCTTATCGGGTCTAAAGAAACGGTAAATCTTGCGTAGAATTGCGAATACCGTAGCACTAGACAG
GAGAAATATCATCGGGCTGAAAGATGCCGAGAGGAATTTAGGACTTTTTTCAGGGAGCTGAAATGAAGACCACAGACGTAGCGGTGACATTTCGGCGAGC
AAGGGCGTCACCTTAGCAATACCAATGTTGTACTGCGCTTCAGAATAGGTCGACATCACTCTTATCACCCCTGAAGAGAGGTGAATAATCTTCTGCCGAT
TCTGGTGCACCATCTCGAACAACAGGGTGGCAAATGTCGGGTCAATCCGCTCACGAACCACGGCGCTCATAAAGCCTACCAAGCAAAAGTAAATGGTAAA
CAGGTCGGCGTGCATCAGCTCCTTGTGAACCAACACAGGTGATGAGCCCGTGATCATTGCGGCTCTCGACATTGCAAACTCGTTGATGGACCAGAAAGAG
TTCATAGCCCATGAGATCAGCACCAATACACCCCGCATAACGAGAGTTGCAGTCGAAAGCGACGCAAAAGGGTCTCCCAACCAGAGCTTGCCTGATCGTA
TCTTCTGGTAGGTTACTAGGAACAGAACGACCAGGGAGTAAATTACTTGCAAGCTGAAGAAGAAGTGAACACAATGCACCCAGGCCCAAGAATCGATAGT
TACCGCCTCGCCTACCCATTCCCAGCGTGTTAGTGCATTCGTCGCATTTACTCCATCGAGAAGTGAATACATCGTACGGACATTGCGCTGGCTGTCACCA
TTATAGAATCCTCGCTTCCGAGCCGTGAGTATGTGCTTAACAGGCTCCGTTCCAGGCTCCCGAGGAATACTATGCAAGGAGAGGTAGCTTTCGTCTGTAA
TTCCCACCACTTCGTACATTTGAAAATCTGGAGACCGTTTGTAAGGATACGTCAGTGCTGCCATGTAGTATTGAGTCACATCCTGGTCTTGCATGTCATG
TATGAGAGTGAGCATACCCAGCACCGCGGGTCCGTGTTTGTTATGATCGCGCTGCTCGTATTCTTGTACAGATAGCGACACTGTCACCAAGTACAAGTTG
CTGATGTCATTACGTGATCGCACCAAATTGTAGACTCGTACTTCGGATGGATCCCCTGCCTCGAGTTGACTGAAAGAGCAATCCACCACCACGATCACAA
GCTCCAAATCCGCGAGGGTGGTGACATTGTACTTAATCGAGGAAACCATGTCTTCGTATCCTTGTGAGAGGAAGTCGTAGCTGTATATTGCCGTGTCAAA
ATGAGGTAGTCCATTACAGCCGTCTGTGGAGGTGTTCGTGCTGGATTCGAGGTATAACACGTAGTCTCGTGGTGTCGTATCGTTTCCAAGTACATCGAGT
ACCAGGGAGCTGCTGCTGATTAATCCATCCCCGACGTAATCTTTGATGAGCGACGACGTGAACACTCGCAGAGTTTCTGTAGGATTTCGCGCACCACCGA
GCACATGAAGTGCCCACCACGTAGCCGTCATCGAAGCATAGACATAAACGCATGCAGATACAGCTGCACCCAACCGACGTGCTAGATTGAAAATCTGCCA
CTTCCGGTCATGCTTCTTCTCCTTGAAATGCAGACCAATGAACTCGCCTTCATGAGTTTTTGCTGTCGAGTCCACTGAACTAACTCTAGGTCGCATGTGC
TTCTTCTTGAACGCTTCAGGTATTCAGTGATTGGTAACTTGCTCTGTGAGCTCTTGGACCAACCAGTAAGCTCTCCGAGAGTAATAAATCTTCGTTTCTC
CGCACACGACATCATTTCTTTACAGCTTGATAAGATTAGTCAATACGAAGTAGTACTACGTCGCAGTTCCTCAAAACTGAGAAGTTCTATTGTTGCTTTT
TGCTGGAGGAATTAGATGTATTATTATAATAGTCGTGGCGAATGCAACCTCGACAGAATACATCCAGAAGCTACATGTATCAAATCACGACGTGTATGTG
GTCTTGGCTATCGGATATTCACGACACCAATCTTATCTACCCCTGCAACAGGAGTGCTCCATACTTGACACACTAGTTAACTGTCGAGAGATACTCTTTT
GGATTCGTACCGACAGAATCGAGAAGATATCGCTGATCACAGGAAAAAAAATGACTGGAAGGCAGACAGTGGCATAGCATTTACATGCTCAAATGTCATT
TAGAACGGCACCGATGCCCATCTCAATTTTTTTCTTTGCGTTGAAGTCGCAAGCCGCAAGCTGAGCAATCTCAGTAGGTATGGTCCACGTTGCGAACACC
TTGCACCTTCAATTGGCTGCAACGGGGGTCGACTGTGGCCAGATTGTCTTGCACACACAATATATTATGGCGGCCGTCGCACAAAGGTGCATACATACAT
GCACTGACATCTTCATTGTCGAGACCAGTACGAGGATCGGCAACATGGGTACAACCTTACGACCGGCGGAAATTTTGTGTAATACATAGAATATCGTTAA
ATTGTGGAGCTTATTCGTAAATCGTGCTTTGTCACACTAAAACTTCGCATGGACGACCAAGGTGGCGGCCGCGCAGCCTCCGCCGCGTCCAAGATATCAG
CCACCAGTACGTCTGCCACTGTAGATTCTCGGCGCGCAGAGCTATCTCGCCTGTTCATTGTCTGTGGACGCGACCGTAAAGTGGACGAGTTGCGTGCGCT
CTTCTCGACGTGTGGAGCTATTAAACACCTCCATTTGGCGCTGGATCGGAGTAAAAAGTCGCGGGTACGACGGCTGCTTCACTTGGCTTTAGTGTGTTGT
CGTAACGCTCCTATTGCTGTTTTCTGACGTGCTTATACAGGGTTTCGCCTTCTTACAGTATGAAGACCCGGCCAATGCTGCCGCAGCAATCGACAAGTTG
GATCACATGAAGCTGGAAGATGGACACATCCTCAAGGTGGGCGCATTGCTGTCTAATGCTATTACTGAAAAGATATGCTGATATTGCTGCTGGTTGCTAT
AGGTGACAGTCGCGAAGGAGCGACCAGTGGGTGGCAACGGCAAATTGAAGCGGGATCAGCACGCGCGACAGGATCTGGACGATCAAACTGAGGGAGGAGT
TGGAGAAGATGACGGGGGCATCGATGCACGGCTTCCTGGGAAGAGACAGCGGTCGAGGCCGCCTGTTTCCGCTCTCCCACTTGGCCCGAGTCGAGTGACG
CCAGCTTTGCTACCGGAGAACCGCTGCCTGGAGGGATTTGGACGAGATACTGTGATTGCTGGTCAACTGTCATTACCGACTGTGCCAGTGTGCAAGGACG
AATCGATGCAGCCTGATGTGGACCTGAAACAAGTGGAGCAAGTGATGTTTGCAATGCTTCTTACAGTGGAGCAAACCGAAACGCAGAACAAAGCGAGCAG
TGAACTATTTGCTGCTTACGGAGTGGTGTCTGATCGAGAGAGTAAACATAGACGTGGAGGCAATTTAAGTGTCGTTGTTCCGGGATCAAAAGACGAAGAA
GAAAACACGACCGAGTCACTAGCATCCAGTATTCGGTCCGTGTCGCTGGCTTCCACGCCAATGACCACTCGAGGGTCTCCGTTTGCTACATTGCGCACAC
CAAGAGTGACACCAAGAGAAGATGTTGTCATGTCACCACCCCGCTCTAAACATCATCTACGCAGACGGCGACAGAGTCTGGATGGCAGCGATTCCAATGC
AGAAGACGGATCTGACGGCCGCCGTAAACGCAGTAACACCACAAACTCACCTCCTCCAACGATCAAAGCCCAGATCCGAGCCAATACTCAACTCTTGTCC
CCGCCGAGAAAACTGTCCGACCGAAGTGACATTAGCCTGTCACCAGACGACCTGAAAGCCGAGATAATATCGAAGAAACTTTGTAAGCGACAGTCGCCGG
ATAACGCAATAGAGGAGCCGTATCGACTAGCCAAGCAGCAGGCAACGCAGGAGAGACGAGATCTTGATGGTGGCATCGTAGATCGAGGGCCTGGACGACC
TAGTATTGCTGATGTAGATACAAGCTACGGACACGATCGGGACGTAAAACTCGAGCTCAAATCGGAACCAGCTGAGCCGACACGGACTAAATTGTTTTTC
ACGTCCACGTATAAGGTGCGAGAGCTCGATTTTTGTGGGGTTTGTATTCCCTGTGAAGTGCCTCTGACATTTGTTCTTGTTGCCACAGTTCACAGAGCAG
GAGCTTGAAGCGATGTTTGCGGTATATGGTAATTTTGAGTCAGCGGAGCTCGTCAAAAGTTTTGGACGCGTAAAAACCATGGCGTACATCCGTTATTCAA
AGGTAACGTGAATGCTGTTAGGAACTGAGATACTGAGGACACGGGTCTGACGTGGAGTACGAGTGTGTAGCCTTATACTGCAGCATTCGTGGTCAAGTCT
TTTCGAGAAGAAACGTATCAGGCTGATGAAGACCCAGAACGGCCGGAATTCATGACGGTATGTCAACTTCAAGTACTTCGAAGTACTATGTGCAAGTACG
TCACGCTAGCTGCTAACTAAAACTTATTCCTTGTTTACTACCTACCAGCTATCGTTCGCACACGATACACGCGACGTGCATTTGCAGCACCAAGCCAAAC
CAGCACAGCTCCACGCGAACAGAGGTTTAGATTGCTCTTCCGATTTATTTTCCAGTCTCGCTCCAACGAACAAACCAGCGTCCACCACGTCCGCATCCAT
GTCCTCTGCTGGGAAAGAGCGTCTCTGGGTGTTGCTGCTGTACGATCGGTTCTTGGCGACACATATGCTATCCTCCGTTGTGTCGTCCTTTTCGGGGATG
GAATTTATGGACATCAAGGTCGTTAAGAGTACTGGTGAGGCTCAAGGAGTGGCGTTCGTGAAGTTTGATAGCGAGGCGAACGCTGCACAGGCAGCACTTC
AACTCCACCAAATGGAGCTGCCTCTCGGTTCAGGGAAGTTCTTACAGGCGATAGTGATTCTGGCACCAAGTCTGTTTACCACCACCCATGGTAGCAATTC
ACTCGGCACCAACGAGTCCATGCGACTCGATCACACAACAGACGAACGTGTTGTAACTGGATCATCCGAAGATGTCGATTTGCGCGCTGTCGAGGCCCGT
TTCGCGCATTTGATGCGAAGCACTGAGTATCCTTACACCAGAGAGGGACAGTATTTCCACCACTACTCTTCCATGCCGTCACCTAGAGGAGCAGCACCGA
GTGACCAAGTATCGCCGATGGCAGGAGACGTGTATCCGCCGCATTCCGGTGGCTTTCACGGGACACACCCAGGTATGGAATATTATCCGATGCAACTGGT
GGCGTATCCTCCACCTCCACCTCCGCCTCCACAGCAACCTTTTCAACCCTATGCAAACTTCGGAGGATCGGGGAATTATCATCAACTACCGCAGCACCAA
GGTTTTGGAGGAAATCCGTCTGGATGGATGGATGCCGGCCCGTATTACCAAGGCGGGGTGCCCCAGTATCCGTTTTCGTGCGCACCAGAGCAAGAAATGG
CATTTCCTGTCGCTGAGAATGGCTTCAACGGGGTTAGAGTGAGTGATTCGCTTGCTGGACCTCCCAAGCCACGCTCCTCGCGCTCGTCGTCTGAGCAAAT
GGATGTGGAGGATGGCAACAGCAGCTGCAGTAGCCAGACGTCTTCTTGTATTCACGTATCAACCAACGAACCACTGGAGCTTGTTACGCTGGTTAGCGCT
CTACAGGACTGTCCTGGGGTCGTGTCGTTTGCGAAGGATGACGCTGCTAGCTCTGACTTGTCTGGGTACATGGTGGAGTTCACTAACGAGATGCAGGCTC
ATGAGGCGCTGCTAACATTGGACGGATCATTGTGTGGAGGTCAGAAGCTTCGAGTGGTGAAGGCAACATCAAACAGGCATCGAGGGGGAACAGGGGGTGG
CGGCAAAGCGCGCACAGGTTCCGGACGTCGAAAACGACAGCGTGTTGACCCTCGAAGCCGAAAATGACGTAGAGAGCCCAACGTGACCTTGAGGTTTTGG
TTAAGTTGCTTAGTGTCGGAACTACATGTCCTAGTGCGTATTGTCAGATTGGGGTTACGAATTGATTCACGTAGTGTGTGAATTGGATGAATGCAGAACG
GAATAACTCAGGTAAGTGCTGGGTTAGACCGTCCCGCTCCATTATTCAGCTTGCACTTAAATGAGAACGTTGTTTACAAGCGAAAACCATAGAACAAGGT
GACGTTATATGCATTTATCGTGCGCGTTCGATAGCACTTACAAGAAATCGCGATTGGGAAACACCGCAGGAGCTACAAGCGTCCAAAGGAATAGTCCGGA
TGCTACCCATTGTGAGACCGCCTTGACCCACATCGTCACAATCTCGTCATCATTCGACGAAGATCTGGGCAACCAAAGGACTGTGAGCTACTACAAATGA
TGCAACGTGGACAAGGAACCTCACCCATCGAAGCTCCCCCAGTTTGTGAGGACCATCGCCATATATAGCGACGCCAGTACCATCAGCACGTGGAATTGGT
ATTCAGGTACCACCTCCACTTCAGGTTGACCTTCCTTATTTAAACGAACTGATGTCAATCCGATACTTGCTAGCTCCTCATCGCCTTCATCACTATTGTC
TTCAAGCTGCTTCTGTGTAGAAGACGAACCGAAAAACACTGTACTGGTCGCTGAAGTTCGCCAACTCGTCCACGTGATCGTGAACGCTGCAACGAACGCG
TTCATGATCACACTCGATTGCTCGTGCAGCTTCTCTTCGGTTGATATTTGCAATGGTGCACACGACGCGCTTGGGTTTGCTCGAACTGTCTGGTAACACA
AGAACACGAGGTACAGGGAGACCGCAGTCGATGGAAGGAGCCCCACATTTACCCATGCCACAACTATACGTACCATCAAATGGATATGTTAGAGAGACAG
TAAGGAATTCCTTTAGTAACGATGCGTACCGCTCAGCGCTGTGAGAATGATCACCGACAACAGCGTGATCGTGATGAACATGGCATTCAGTTCACACTCT
GCGTAGCGCATGTACATCAAGGCGAGTCCTACGATTGACAGAGCCATGCAGATGAAAACCAGAGCAAGATACGCTCCCTCCCTGTGGCAAAAAGGCGTTA
GTGTTTCACTTTTTACATCTTTCTCCATGCAGCGGTCTCACCACATGGTCTTCCTTCCGTCCCCTTGTGTCGAGTCAAAACTGCTGCCCAGCAGTGCATG
TCGAGCGTCATCGTCGCGATCTGCCTCGTCCATCTTTTCCAATATATAGTCCCGAAGGCTGTCTGCAATGCAACTAGCAGTCAGTATCTATTGGGCAACT
AGCACATCGTCACGTCCTACAAGTCGAGTCCAAGATGATGATGATCTGCAGGGTGATAAAGAGCGCCGACGACACCCGCGCAATGTCCACGTAGCCATCA
AAGAAATCTGCAAAACAAACAGCAAACTCGTTAATTCCGTTCACTTTGTTCGTATTGAGTCCACGACCTACCATTGGGGATGAAGAGTGAGGCCAGGAGA
ATGCCAAGATAAAAGGGTAGCTGGAATAGCAGCATGCAGCATACGCTCTCGCAGCCCTTGGCCACCGCACAGCTCAGCAACGCGGTGAGTGAGAAGAAGC
AGCCCAGACTGAAACTGATGCGGTAGACGAGCTGGTTGCCAACGCAATTGCTCGGGAACGGCGAGTCATCGCACTCGTCAAAGACCCCGAATCTCGATAG
AATATCTAATAAAGTGACAATTTCAACCGGTAAATGCAATTTTCAGCCTCATACAGAGAGTGACAAGCGAGGAGAGAGTGACGGCATTACTCTGACCAAA
GGTGCGCAGCAGACCAGCGCACGCAGCGCTCACGAAGAAGAGCGCGACGTAGCCAATTCGTGCCATCACGTCGAAGAGTTCCGAAAAAAAAAAAATGAGT
ATCATGTAGCCATTTCGTTTAGGTACGATCCTCCCACTTCAACTACAGGAACTATCATTGGTAGAGCTGCATCTGCGTGGGCGGCACAATGAGGTCCTCG
TTAATCGGAGCGGCCAGGTACTGTTTGAGGAGGCTCTTGAGCTCTGCATTCTGCGCCTTCATGGCAGTCACATCGTTGATGAGCTCTTTACGTCGCAGAA
GTGCTGTGTTGTAGTGGGTCAGACCCTTCTCAAGTGTAGCCATAATGCGGATCTTTTGTGCCGGGAAGACCTTGACAATGTTCTGCCAGTATTCCTTCTC
CGCCTTTCGCGCTTTAGCCTTCAGCGCTGCTGAGCTGGTTTTCTTGCTGTTCTTGTTTAACGTTTCAGGCTCACTATTCGTTGATCGTTGCAGGATTCGA
GTCACCGGAGCAGCTCGCTTCTGCTCATTCATCTCCTGTTTATGACAGACACCTAAGTAAGTTCTCCTACAGGGATTAAATTAAGGAAACGTGGACACGA
ACCTCAACAAACTGCTTAATAACTCGGATGACGTCCTCTGGCCCAACCACGAGACCCCACGACGCCATCAAACCATCTTGACCCGGGGAATTGTTGTCCT
TACTGTTGTCTGGTACTTCTTGCCGCGGATCCTCGAAGAAATACCCCATCAGCTTCTCCATGTCATCTTCGTTGTCCACTCCAAGCGCTCGCATGATCAT
GTCCGCTTTCACCAGTTCAGCCTCGTCATTAGGAAGATTATCGAGAGCTTGTTGAACACTGCCGTTAACCAAGAACCCAGCCTCAGAGGCCAGCATTTTC
AGCATGTATTTCAACTTGGCACCAGATATTTTCTTGACTGGAGGAGTGTACGCTTCAACCGACTCGT