Description :
From Genome Similarity Track
Location :
Scaffold_2020:717- 5693
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2020-fgenesh-gene-0.0Myosin

Sequence
4976 bases(100 bases per row)
GTACGGATCCTGTGTGAATGCGTAGTGGTCAGCGAAGCATGTGTCGCACACGCGCACGGGCTCATCGTCAAAGCCGATACCAATGAGCGTCACGCGACGG
CTCGAGTGCTCGTGGCAAAATGAGTTACCGCACATGCGGCAGTGGTGGCGCCGCACGAAGATGTTGAAGCCTTCCTCACACTCGAAGCACTGGTTGCTTC
TCGCCCACTTGACGATACGTGGGATATGACGCCCGCCGCCACCACCACTATGCATGCTGCCGCTCATACTTCTCATCCGGGTTGGGAGTGATCGCGGCTG
GCCTGGGAGCATCGCCGAAGTTGGAGTTGGCGGGAAGCCGATCGACCCAACGCTATACCCGCTTCCACCAGACGACGGCTGCTTGCGATGCGATCCCGAA
GGCGATAGGAAGTTGTGGTTGTACTGCGTGTGGTCATGAAGCAGACCAGACAACGAACCTGAAGATGCAGCAGAAGACGATCTGGTACGGCGAGAGCTTG
AATACGAAGTCGGGGGGCCTTCGCGGCGACTGTGAATCGCCTCTTCCTTCTGCACCATCGACTGACGAAGCATGTCCATCTGCTGCTGAATGTTGCGAAT
CATGCCATCCATGTCTCCGCTCGGGTTGTGGTCACGTTCACTGAACTGGCCATCACCATATCCCCCCGTGTCGATGACAGAAGGGTAACGGCGACGATCC
CAGTTGCTGCCACCACCACCACTGCCTGACGACCGCTGACTCGGCGCGTAGTTCGACGATCGCGACGACTCATCAAACGATTTCCGCGCGACGAGCTGCT
CCAGGAACTTGCACTTGGCATCCAATTCTTCGATCTTCTGGGACAACATCGAAACGTGGTCCACCTGGCGCGTGTGATACACGCTCTGCGCGCGACGTGG
CGGCAACAGTGACACCTCGTCGCCATCCTCGTCTTCACCAGCTGAGAATTCGATTTCGTCCATGGACAGGCTTCTGCGACTCGCGCGAGCCTGGAAATCC
ATCGGATCTGGGTACATGTCCTCGACGCCGAACCTCGAGTTGCGATGCGACGAACGAGAGGAGCACTTTTCTGGTCGAGAAGCGCCGCGACCATTTTGCT
CTTCGACGAGCATCTGCTTCAGACGCAAGATCTCATTCTCCAGTTGAAAGTTGCGATCGTCTTCGTCATCGGCATCTCGTCGCTTCTTCTTTTTTGACGA
TTTCCGCTTTGGCTGCGAGCGATGATTGTCGGTTCGCGACACAGTTTTCTTCCGAGGAGTTTCGTCCGATTGGGAGTCGCTTTCAGATTCCGCAGGGGGC
TGAACGCGTTGCTGCTTCTCATTTCGCGTGAACGATCTTTTCTTGATCGGAATTTTCTCAACGTACTCGTCGCTGTCTGAACCACCCTTGAGGCTTGCCC
ACGACTGTACATCCGTCAACGCTTCCTCGTCTTTAGATACGCGGATCGATGAGCCACTTCGAGATGACGACGCGCTTTGAGGCATCTCCGGGACAGGAGT
TTCTTCCACCTCGCTTTCGTTCTCTTGAAGTCGCGTATAAGCAAGGCGGAAGAGCTTGAACGCTGCTCGCAGACGGAACGAGCGGATCTTCTTGTCCACA
ACCCGATTGCTCGTCAGCTTTCTCTTCCAGCATCGTTGAATCGTGCTGACTGCTCTCTCCTGGCGCACGCGTCTCAACTCTTTCACTTGCTTCCGAGCGA
TGAAGCCTCTGATAATGGATTGAATGCGGTGGACAAAGTCTCGGAGCTGCTGGAAACGACGGCGACGACGGTACCCGCGATAGTGTCGTTGCAAAATGGT
TGCAGCCTGGTCCCTGAGCTCCAAGCGCAGACGGGAGAACTTGTTGAACGCCTCAGTCTTGCAGAAGACCAGCGTCCGGCCGACTTGAACTCCGTGCCGC
CGAGCTTCGTCGGCTGCGTTGGTTTCTCCATCCGCGTCAAAGATATTGCTCGTAGCTTTTGCTGATTTCGCCTCTCCGTTGCCTTCCTTAAGCATCACTT
CAGCCAGAAGACCAGCCACCAACGACTCGCAGTACGTGTGCGGGGACTTTCTCGCAGCTGCAGCGCTGGCACCAGAGACCAGTGAGCGGAAACCGGAGAA
CAGCTCAATAAACGTCGAGTGGCCGAGGCGGACAGAGTAGCCCGCACGAGCGATGCGCAGAGCTTCCAGCACACCGACGGAGCGCAGTTGTTCCACCATT
CGCTCACGATCGAAGATTCCTGGACGTTTCACCTCATTCGGCTTGAGACAACGGACGTAGTGCGCCTCGGTCAAGCCGATTTCGTCAACCAGTCGATCAA
GTTGGCTCTTGAACTGCGCAGACACACTTGGCGCTCGCAGCAAAGAGTAGCGGCGTCGGCCCGGTGCTCTCTCAGCAACTTGCTCGATTATCTCGACGTC
TCCAATCGCACTCACGATCGCATTCGACGAGGAGTTGAACACGGTGCTGGCGTCCGCAGGAAGCATATCCAGGTTCTTCTCGATGAACTGCTCGATGCGG
TAGCACACCTTGCCAGCGAAGTGATGCACGACGAACTGGTGCTTGACGCGGTCCATCTTCGACGCGAAGAACGGCTTTTTGCTTGCGGGCTCAGGCTCCT
TCTCGATTTGGTCAGCTGGCTGGTGCAAGTACTTGCCGAACGACGTCATGATCTGCGGCAGCGTGTACTTTGGCATACTCTGCTGGCTTTTTAGCATAGT
GCCCCCCGTGACGCCTTCGGTTCCTCCATGGTACCGATAAAACTTCGTCCCGAGCGCTTCATCCGAGCCTTTCGGCATCAAGCACTCCTGGTCAAGCAAC
GAAAAGAGACCGTTCGCCTTGTCGTCAAAGAGCGACAGACAGGCCTCATTGCTTGGGTACGGGATCGAGCGCCAGTCAATCCCCTCCGAGACGTACACGT
CTTGCTCCTTGATGAACACGAACTCGTTGAACTGCGCTTGCAGTCGCTCGTTCGCGTAGTTGATGCAGAGCTGTTCAAAGCTGTTGCGGTCGAGACTCTC
GAACCCAAAGATATCGAGAATGCCAATTGTCTTGATCTCAGGCGCGTCATAGTCGTACACGTCCGAGTTGTCGCAGTAGTTGATCCCGTCGCTCAGTCTT
CGCACCAGCCAGGAGAACACTCGTCCATAGATCGCCTTCGCCAAAGACCGACAAATGTCTTTCGCCTGCTCTGCATTCTGCTTCAGCACCATAACTTCTG
AGCCTGCTGTGATCATTCTCGTCAGCAGCAGAGACTCCAGGTCTCTCGTTGTCACGCCCAGCAGCTCGGCGCATTTCACAAAATGATGCCGCGTCGCTGC
GGTCACCGCCGCTGACTCCTCTCGCGTGCCCGAAGTGCCTTTGCCCTCGTGGATTTCCATCATGAAGTTCACGTTCCCCAAGTGCAGCAGCGCGCCAAGT
ATCCGGAAGACCAGGTTCTGCTCCTCGCTGTCGACGCCCGTGTCTTCGAAAGCCTGCACTGTCTGTGCAAACCTCTGCGCGAACTGGTTCGCTCCGATCG
CCGCCCGTCGATTCATCGGACCTCCGTACGCATTCAGCAGCTCGTACTTCCCGCCGCGCTTCAGGCCGAGCTCAACCAGCAGAGACTCGTCGGCGCCCTC
GAGCAGCTCATAGAAAATGTGAAAGTTACGTTCGCCGGGGGACTGGTGGATTAGCCGCACTTTCTCCAGCAGGTACGACGCGATCTCGGCGCCGACGATC
TCGTTCTTGTAGTCAAACTGGATCTTAATGAACTTGCCGAAGCGCGAGCTGTTGTCGTTGCGAATCGTCTGCGCATTGCCAAACGACTCGAGGATCGGGT
TCGTCTGCAGAATGCGCCGCCCAACCTCGACGACTTCGTCCGCGGCGTGCTCGCCCGCCGTCGCGTCGCCGCCGACGGATGTGAGGAACTGCATGAGGAA
CTTGGTGGACTCGGTCTTGCCCGAGCCGCTCTCGCCGCTCACGAGGATCGATTGGTTCTGCTGGTCCTGCTTGAGCAGTCCGCCAAACGCCTTGGCGCCG
ATCGCAAACACGTGCGGTGGCGCGTTCGCAAGCGCCGAGTTGCCCGCGCCACCGACAGCCGCCGAGGTCGAGCTGCTGCGCGCGCGGTCGGAGGTTGTGT
CGCCCTCTTGGTACATGGCGTCCTTGTACTGGTCGATCGTGGCCTGTGAGTAGAGGTCGAGCGGCTTGAGCGGGTTCACGGCCACGAGAATGTCGCCGAT
GGACGTGTAGATGTGGTCGTTTGCGAAGCGCTCGCTGAGCGCGTGCAGCAGCGCCGGCTCATGGAGGTACTCGAGCCCCGTGAGCGACGCGAGGTGCTCG
ACGCGGCGCTCCTTGTTGCGGATGTAGAGCTCGTTCGCGTTGTCCTCCTCGGCGTACACGCTCGTGACGATGGCGCCGTCCGCGAGCTTGACTTTGACGA
CGCCCGTCGTCTGGCAGTCGAGCACGACGCCGGGCGCCCACACGAGCGCGTCGCTCTTGACCCACACCTCCATGCCAATGTCCATGGCTCGAGTGCGGGC
TTGGTGGCGGATTCAAGAGTGATGGTTGTTGCGCGAGTATGTGGACTCGAGTTGCGCGCACTTGCGTGAAGTAACACAAGGCGGCTTGTTGCTTGTTGTT
GCTTGCTTGCTGGAAGGGTCTCGCAGGCCGCAAGCGCGCTTGCTTGCTTACTTGTTGCTTGCTGGACGAGTGCTGGTCTGTTTCCAACTGATGGCTTCTC
CGCAGCAGCTGGTTTTGCTTTGAGCCGCTCGATCGAGGAAGCTCTGCTCGCCGCTCGCCACCTTCTCTTCTTGCTTGTGCTTGCCTTGTGTTGGCAGTAG
AAGACCAGCCGCATAACGAAAGAGGAAGGAGAAAGGCCAGACCGTCTCGCGCGCCAAAGAAAAGCCAGACTTGCCATTTGTATGCGAAAAGTGGAATTCA
ACAAGCAGTGTTTTTGGTTTTGAATTTTGAATGCAGCATACAAATGTCAAGTCTAGCGCGTTTTTCCGCATGTGAA