Description :
From Genome Similarity Track
Location :
Scaffold_470:717- 4717
Transcript NameFunction/comments
Phyta_totarag8583hypothetical protein

Sequence
4000 bases(100 bases per row)
GACCTCGCTCTCACCGGCTAGTCGGTCGGGTTCCCAGCTGTCTTCAAGCAAGAGTTCTTTGTCGAAGCCTAAACGCGAGTCCTCAGTCACATCTTGCGTC
AACCGAGTCTTCccttttttcttcttttttctCTCGGTCTGTCCTCAAACTCATTTACCACCTTCAGGCGCGACACGTGCACCACGGGAAGTACTCCTGT
CGGACAATTCCAGCTTACGCGGAACGGACTGTGCCATCGGTGGGCAAGCTTCTTGGCCAAACTTGGCTTGACTAGCTCCATCTATGCCCAGACTCGACTT
CCAGGCTCAAAACGAGGTTTCGTCATCGCTTCGGTAGGTACTTCATCAGTGTACCCGTCATTTTGGTGGTCGACCGCAGCCTCACCGCTTGATTGTCGAA
GCACAGCTGCCTGCTCCTTCCGACACAAGGCCTCATTGTGTTCCTTGGCTCAGCAAGCCTTCTCAGCGGCTTGGTATCCCTTGGCCATTTCGAGAGCTAA
CTCCTGTTGACAGTTGACTTCACGACGCCACGCCAGTGCAACTGATTACTTACCGGACCCTCGCCGAAGAGACGAGGTCATTGCTTGCAACGTGGAGTGA
GTGTCCCACTCATGTACCAGGTAGAACGGGGTTTCTTTTCGCGTCGTGTCCTGAGAGCTGTTGATCGCAACCACCAGTCCTTCTGCGATCCCGTCTCAGT
CCTGCTGCATCGGACTTTCGGCGTACACCTTCACGGACTTCATAACCGTCTTCGCCGACCTTTCCTGCTGTCGGTAGCTCAGTGTCGCCCTTGACCTTGA
CTGCATCATTTCGGTAAAGGCTTGGAAGCACTCGCTCATAAAGCGGGGATCTCGGTCGTGTCGAATTAGCGACGACGCCCCAAAACGTATGTATATGCAC
TCTTCAAACACTTGAGCCACCATGAAGGCAGATGTATCTGATATGGCCTTCGCGAGGACGAATCCTATGAACGAGTAttgaaacagcaacagcgccgTGT
TGCCGCGTCGAGACTTCGGTAACGGTATAACGAAATCCATGGACACTATTTGGAATGGTCGTTCGGCAAGAATGTTGCCAGGTGAGTATCCTCGGAGCTG
CGGTCGGCTCTTGCTCGAACTACAGTCGCGGCTCGACTTCAAATGCTTCTTCACATCGGCGTATAAACCTAGCCAGTAGTAATTCAGCTTCACCCGTTGG
TATGTCCGAACTACACCATGGTGTCCACCTTCCAACGAGTCGTAATAGTTCTGCAGTACTTCTTGAATCATCGTTGTTGGTACCACTAGGCACAGCTTGA
TGTCCTCGGCTTGTTCATCACGCCTCCGACGGCTTGTTCCCACGTAGTAGAGCAAGCCGTCGTCTGTCAGGACGAACTTGTCGGCTGACTTCCAGACATT
ACGAGCGTCTCTGTACCCTTGTTTCTCCACATCGCCACGCAACACcgacttcaagttgaacCATctttgtgttttttttttcgttCTGTGTCTTGGCAAT
ACGGCGTCGCCTCTCTTCTGGCACCGCCACTGGGTCAATATCATCCGTGTTTGGCGAAGGTATTTGCTCGGGCCTGggttgctgcttgtctgtCGAGTTC
TTGGTAGTTGCCTTTGTTGGTTCTAGCAGCTCGCTTGTGCCATCTGGTTGGTCTGTTGAGGTTTCGTCAGCGAATCTAACTTGCTTCTTGCGTGCTTGGC
TCTGCCGACGTGGTATCATCGAGGCTTCTCCATGGTCTGGTCGTACGAAATCTACAAACGTTTGCGTGTCGGCGTACTTCGACCATCCAGAATTTGAACG
ACATTGTCGGAGCCGGATTTGGTCTCGTTGATGTTGTCTGATGAGAACTCGTAGATCATTTCGGGTATCCTGCTCAGACTTGAGAGCTCTGCCATCCTGG
CCGCGCCGAGAACCACCTTTGACACCTTCGTCTGCAGTGTTTCGCCTGCTAACGAATCTGCCTCGGCATCGTACTCCCTCATTACGTGTAAGTACTTCGT
AGTCCGAAGCCTCGCTGGGAGTTCCTTGTGGCAATTCAACAACTCCATCAGCGACTCCTTCCGGCATGCGATCACCCCTAGGGATTACTGGATTGCGAGT
CTCGAGTCTCCAACAACCACCAAAACTTCAGCACCGTGCTCTAGAACTGACTGTACACCGTTGCTCATACCGGCGTACTCAGCCATATTCACCATGGTGT
TGTCGAGATAAGCACTCGCAGCGATCACTATCTGTCATTCGGGAAATCGCCACACAATCCACGAATAACTACCATACCCGCCACGTTTCCCCGTCTTTGC
TGATCCATCGAAAGACACAACGAAGCCTCGGTAGTCGCGAGGCATACGGGCATTGAGGAGGTTTGGGTCCATGCGAACTGTTGGCGAGCCTTTATTCGAT
GGTGCCACCAGTGCCGTCGAACCCTCGATATCGACGAATTCGTAATTGTCGACTGGAGGAGTTGGGCAAATGCACAGTCCGACTCCTTGACTCGCCGCAC
CTTTAAGTGTCACTGTGATAGCAGTACCGAAAACTGCACTGCTCGGCCGAAGAGAGACTTCGACTGGTGGACCCATTTGAGCGTCGAGAACCGAGTGTAT
ACATGGAGTGGTCATCCGACTAGTTGTGTGTAGCATATTTTTAGCAAGAGAAGTAGGTGCAACACCTCTTTTTCGGCCGGGTGATAGTTCATTTCTGCAT
CCCTCAGTACTCGGCCACAGAACCGTACTGGGTGCAACCTGTTATCATGTTCCTGCATCAGCGTGGTGCTGAGGACCCATTCATTGGCaaacagcatcac
gtgcaCCTCCTTGCTCCGATCGAAGCGAAGTACCGAAGGATAGGCGCATCGGTCACATTCTGCTTGAGCCTAGCGAAACTTCGCCGTGCCGTCGTAAGGT
CACCTTCAGGTCCAAAAGCTTCGTCCTTGAGTTGGTAGAGCGCTGCGCCGTACACAGTGAATTCTTGAATAAACCTGCTGTAATAGTTCAGCGCACCCAA
GAGGGATTGCATCCCCTTCTTGGATTTCAAGAACGAAAGCTCTGTGATAGCTGCAAGTTTCTTCGGATCGGCTTGAATGCCAGCTGGCGACACTTAATGT
GACAGAAAGTCCACCTTCAACTGGACGATGATGCTTTTCGTGAAACTGACACTGATTCGACACTCTGCGAATCGACTTAACAGACAATCTAGTGTTGCCA
GACAATCGTCGAATGGCGCCCCACCACAGATATCATCCACGAAAGAACGCTGCTCAAACACCGGCACAAGCGTCGACTCATCTGCTTCACCGGTCGAAAA
CATATCGACCACCGGGCTACTGACGAGCTGTGATACCGGATCCAACTTGGTCGAGGCGTCTCGATCAGCGTCAAATTTCGCTCGAGGGCTCGGTCTGGTG
TCCGGTAACTCCACCGAGACATCGCCATGATCACCTGGTCTACTTCTCTGCCGTTTGCATGAGCTGGGCATAATGTTGCCAACCTCCTGTCGGCTGGGCG
AACCCCCAGAGCGCGTTGTCAATCATGCGCTGATAAATCATGGGTGCATTCTTGAGACCAAATAGCATTCGTAGCCACTCAAAGTGCCCCAGTGCACAGA
CGAACGCCGAAAACTTGCGGGCTCGCAAGGTCATCAGGATCGCCCAGAATCTGCTGGCTTCATCCACCGAGCAGAACCAAAGGTAGCTCTCCAGATTTGT
AAGCAAATCATCGACGAGCGGCACCGCATACTCCATGACTGCTGTGACGGCATTCACCATCTTGTAATCGATGCACAACTGGATGTCGATGCCGTTCTTT
TTCAGCACAGTCACAATCGGTGACGCCCATGAACTGTTCGAAAATGCGATCAAGCCAGCCTTGAGCACCCCTTTTAAGAATTCGTACAGCTTCTGAAGGT
GACGTAGTGGCACTCGTTGGGCACACTGTTTAATAGGTGCATGTCCCTTGACATCAATATCGCATACGACTCCGCACGCAGGTGGAGGAAGTGCATTGCC