Description :
From Genome Similarity Track
Location :
Scaffold_961:717- 4636
Sequence
3919 bases(100 bases per row)
AAGAGTTCCGACAGCGACCCTGCTATTGTGAGTTCCGATAGCAGCCcTGTGCTTGTCGAAGACCGACCGAAGGTCGGTAAGAGCCAGCAAAATGCTGGCA
CGAGGGGCCGATCGCGTCCGCGCGATGGGTCAAGCCGCGAGCAGAGTCCCAGGGCCGTAAGCAGTCTGTGAAGAAACCCTCTGGTGATGTCAAACCGAAG
ACCAAGCGAAGTGAGTCGAAGGAGCGTTCTACCGCTCGGGACGCAAGCTTCGCAAAGCCAACGAAGAAGACCCCAGAGTCGAGGGCTCGGGACACTAAGT
CAGTGTCTCGGGACGCCAAGTCGGGATCTCGAGCCCCTGATCATGAGTCACGACAATCAAGGCGGGATTCTCGGGATGCTCGCACACCAGACAGGAGTCC
GTCGAAGGCAGGCTCAGGAAGAGGCGCGTCCGAAGTGCTTCGGGACGCCAAAGCTGGTGGGATGCCGAGTTTCACAcTTGGGCCGGgACGGGGTCCCGAA
GCTCAAGATTCCCAAAACCCTGGGAACCAAGCGAAGGCCCAGTACCTGGCCGCGTGCTGTTTGGATGACTGGGCACAAGTGGACAAAGTTCGAGTGACGC
CGcACCAAGTGGCTGTCGGGACGCTGAAAGTCCCGCAGTATTTCCAGGGACACGTCGCCCAAGTGCTCGCGAAGTCTCATGAACCGGTATGGCTGCAGTt
GTTtCAAGTGACTGGTGTCGGGCTCCCGACTTCTCCTCGCTTGTCGCTCTACGAGATCCGGTTCGACCTACTCTCGGCACTCGAGGCAATCGCGGTGCTT
CAGTCGATGCTGTTCGAGACCGGATATTCATTCGTgAaCTTGGTTCCCGCGTTCCTGCGCGGAAACCGCAACTAGTCGGGATCACGCaTGACGACTTCGT
TCGGGAAGCGATGTCCGCCTCGTACTTGCTCGCACTCCAACTCGAGGATTGGATATCGTCTCGAGCCGCCTTCGGAGTTCGGGTCGCTTGGCCTGGGCGT
GAATGCGATGAGATCTCCTGTCTCCGTGCCAAGCACGTCGAGCGAGGTCTCGATCCCACCTCGGGACTCCACCCTCGGGAGTTCGAGTTCAGTCGGGAAG
TCGGGTCGCGTCCCGATTCTAGAGCGCGACCGATTCTTCGCCAGGGCAGGTTTGGGAGCTACTGCACCTGCATCGCGACTGGTTCCGCCCCAAGCGTACC
AGTTTCAGCAACCTGCCGCTGTATATGGCGTCCCGAACAATGTCGAGCATACCGTGGGCAACCCGTTCGGGAATCCCGGTGAGAACTATACGCCATCCCC
GTCCCTTGATTTGTCGATGGAAACGGCCCCAGTTCCAACGTATCCTGCGCCGACATTCGCCGATGCGCCTCAGGCGCCCCGACCCCATGGGgACGCGCGC
ATCCCCACcTTCGCCAACGTCCTGCAGAAGCCTGCGCGTCGCGAGAGCGTCTGGCCGGCCGCCGCTCCAGCGCCGACGCTGCTTCcGTTCCCcGATGCAA
ATGCGTATGTGATGGCAGCGAAGCCCTTCATTCCACAAACGCTTCTCGGTGACTTCGATGGAAAGGACAGCTTGCCCGCGCGCAAAGCCTGGTGGAAACA
ATACCAGTACATGGCCGGGTCAGGCATGTGGTCAGAACAAGAAAAGTGCAAGAACCTGCTGTCGTACCTTAGAGGGCCAGCTGGGGCCTGGTACCAACAG
CTGGGTGAAGCACGCAAGTCATGGAAGACCCTGTCGCTTGCGTTCCACTCGGAATTTTGCAGCAACCGTCAGTCCCAGACTAAACAGTACTTCGACCTCA
AGCAACGCTCGGGAGAAACGGCGAGAAACCACCTGTGGCGTTTGAATGCCGCCGCCCGTCGTGCTGGCGTCCCGACCCGAGGTCCCGACGCCATGGCCAA
GCACGTGACTCGATTCTACAAGTCGCTTCGGGATTCCGATGTAAAAGCTTGGTTGCGAGGTCGTACGTTCGGGAGTGTGGAAGAACTCGAGCGCGGCCTG
ATTGCATACGAGGATCAAGCGTCATCGTCCCGAAACGAGGATCGGGAAACCCGTTATGCTCGGGATGCCAGTCGCTCTCGGAGTTCCGAACGTCCTCGGA
CGAGCCACACGTACTACGCGTACAGTGGTGACCAGGACGATGAGGACTTTGACGATTCCTCGGGATATTTGCATCCCAGCAGGTCGGTACGATTCGAAGA
CGAAGTGTCTGAGGCCGACGATGATGACGGCACTGACGTGTTCCAAGCCGTTTCCGTCAAGGACCAACGCGGCCCGAGCTGGCAAAGCCAGAGTCCCAAC
AGCGATGGGTACCCCCGACCGAGACACGCTCACGGTTCGGGATCCTATGGTCCAGGTCCCCAAGGATCAGGAACCCAAGTCCCGAAGTCGCTCGGGACGC
CGGTTGGGACGCATTCGTCCTCCGGTCGCTGTTTCGGGTGTGGTGGCTTCGGGCACTGGGCAGATAACTGTCCGTCCAAATTGGTGTGCACTGCGTGCAA
AAAATGTGGGACACATTGAAGAAGTCTGCAGGAAGAAGTGTCCCGTGTGCACGAAATATCACACCACCCCcGCCGACTGCGAGGTCCTTCGGGAAGCCGA
ACAGTGGAGGGCGTGGGCCAAGACTGAAGGAGTAACCGTTCTGGAGAAAATCCCGTCAGGGCTCCGTCAGCATTTAAACTGAGTAGCTCGCCGGAGATTA
GGGATCCGGTACGCGCCGAGCTGAAGACCTCAGTTGCACCTGTGGGAGCCGAGCTCCAGGTGTTTGCATTCGTCGGGATAGATTCAGCTGATACCGACAA
CAAGCTGACATTGCATTTGCATGAAGCGCGTTCATTTCTTGCTTTtGAAGTCAACGATGTGGACGAGGACTCGTGTCCCGAGGAGATGACGGGAGCCCGG
gTTTTGCTCTACACCCCGGTGAACGCCGAGGCTGGTGGTCTCACCACGACAAACCCGTCGGGGACACCAGGATCTCGAGAGTCCACGGTGCCGTGTGTGA
CCGCCGCGTCCCGATCCTACTCGACTCGGGATCCTCGACGAGTATGATCAGCCTCGATCTCGCAAGACGGCTCGGGATCCAATTGAAATTTGGGACCGGG
ATCCGCATGAGGGGAATTGGTGGCGTCGTCACACGAGTCACGGCCCGAGCCAAGATCAAGATAACGCTGGGGATGAGTGTCGTCTACTTCATGGAGGTTT
GGGCCGCCAACATCGGTGAGGGTGTAGACTGTCTTCTCGGGATGGACTTCATGGTCGCCGCGGGCGTACGCCTGAGTGCGTACGAAGGTGCAGTGCGACT
CCCAGACGAGGAGCGGATACCGCTGATTGCGTCAGGATCCCGACCTGGTCTCCCGGGgAAGATCCCGATCTCGTCCGCGACCGACATCTCCcTTAGCCCG
GGAATGTCGACTTCTGTCCCAGTGACAAGTGGTCGAGATCTCAGGCTGGAAGCTTGGGGATGCCGAGGCgACCGCTGGGTCACGACAGTGTTAATGGAGC
ACGGCGTCCCGACAGCAGTCCGGgTGGTAAaTATCTCGGGACGCCAAGTCAGGATCCCGTCAAGGACCCCAGTCGCCCACCTCGTCGAGCCGGGACACCT
TCCCGACGCTGACCGCTGCGCTCGCCCAGGCACCGCCCGGTATCAGGAGTGGCAGAGTCACATCTACGAGAGAGCCCTCTCTCGGAGAGAAGTCCGACGT
CGAGAGCTGGAAGATGAGgCATtCAaCGCGTCGCTGCCACCAACAGTCGAGAAGCACGAGTACCAAGCACCGACCAGTATCCTTCGCAGGGGTGAAAGTT
TCGAAGAGCCTGACATTGGGGATCCCAACACTGGTCGGGACGCTGACGTTTCCTTGGAAGAGGTGTTTCTCTCTGTTGCCGCGAATCCCGACCAAGTCGA
CTACGATGATGCCGAGGTA