Description :
From Genome Similarity Track
Location :
Scaffold_1982:717- 2566
Transcript NameFunction/comments
Phypl_g14495hypothetical protein PHYSODRAFT_342227

Sequence
1849 bases(100 bases per row)
GGCCGCGTGTCTTCCATGCAGTGGAAATTGACTGGAACATCCCTGACGAGTGCATCACAGTTCCACAAAGGAAGATCGACAAACTGCGATCCGTTCTCAC
AGAGACGTTGGGAAAGACCTTCCTGTCGAGAAAGCGACTGAACAGCGTGATCGGCGTCCTTCGACACGTGATCAGCTTCATTCCGATCACGAAACCATTC
ATCCAGCGCTTAACGGCGGTTCAGAACCGTTGTCGGAGACTCAAGAGTTCAGGTGTCCCGATGACAGAGTTCCTTTGGAAGGATCTGCAGTGGTGGAAGG
CTCTCTTATTCCAGACTGAATTCGCGGGGATGCCGATGAACCTGTTCGACCACACCAAggccttcgacgaggcctGGCTGGTCATCGTGGCGAAAGGTAC
AATCTGCGTCACGAGTatgaagctccaggagcaTCTGATCCTCAAGCAGCAGGGCCAAACCCGAGACGGCAACGAGCTTGCACATACCCTGGCCAATATC
ACAGACACGTGGGGGCCAAGCCTGTCTACGGAGGGCACCTGGTGCCACGTCGTCATCCACGGCGAGCGATGGATCACAGAATTGGTCGACAAGATGAATT
GCAAGTATCGGGACGGACAGCACGCCCTGAGGCAGTGTGCCCTGAGCCAGGCTCATTACAGGCTGCATTTCACGACGAAAACGATGCGACAAAGATTGGA
GCAGACTTCGAAGTGCGACATCCACGTGGGTAGCAGTACTAACTATCGTAACATACAACAGATTGAGAGAGACGCCAGCGAGTGGAGGAAAAGCGagacc
agctcaagcaggtCTCAGTCTCAGTCGGGGCGCATGAAAGCTACAGCAGGAACTTCAAGTTTTGGGAGACCTTCTGCAACGACTTCGGATTCCCCGTGTG
GATTGACGAACTGCCCAGGGCACAACAAGGCAAGTAAAGGAAACAAGTGCCAGACATTCGATGAGAAaatggcagcagtggcatTCGCACACAAGGCAGT
TCGGAACGCCAAACTCGATTACCATGATCCGGAATTTGAGCTCATCGCTCAAGGATACAAGCGCACCCATGGTGACGTGGACCGGAAGCAACCAGTTACT
ACACCGATGTTGCTCAAGATGCACGAGCTCGGAGCCCGGCGCGATCTAGAGAGCGATCTATTGTGGGGTCAATCATCCTagcgttcttcttcctcgaccg
ATGCTCAGAGCTGTGGGGCCCGATGGCCCTTGACAAATCGACGGGGAACATTCGGACCCACTGCGTGAAAGCGGCCAACGTCATTCTTCGAGACAAGCTA
GGAACACAAGTCGGACATGAGGAACCGGAAGCGGTGTCAGTGGAGGTGATCTTCGAGTCGCACAAGGGCGACCGCGTGGCCCAAGGCACGACGATACGAC
ACTACAAGTCCAACCATGCACACCTGTGTCCCGTTGCAATGCCTGATCATTCGAGCACAATGACTTTCTACAGGGCGGAAGTTGGGGCTGTATCTCACTT
CGGTATCGACTACCCGGACAATCAAGAAGACACAAGTGGCTAACCTCATCAAACTGTCAGCTGCTGACATGGGTCTACCACGGTCCGACTACTCTACCCA
CTCGCTCCGCATAGGAGGGGCCCGCGCACTGCTNCACGGTCCGACTACTCCACCCACTCGCTCCGCATAGGAGGGGCCTGCGCACTACTGGCAGCGGGCA
AGAGTGACCTGGTCATTCGACTCCTGGGTCGCTGGTCTAGCTGGTGCTTCACTGTGTACACCAGACTACGACCTGGAATGATCCGAGACGCGGCAAGTTG
CATGATCAAGGCATCGTACCGAAccagaagacgcagcactCGGGAGGGG