Description :
From Genome Similarity Track
Location :
contig_78:71691- 73328
Transcript NameFunction/comments
g11990.t1XP_009538014.1 pepsin-like aspartic protease A1 [Phytophthora sojae
g11991.t1XP_009538508.1 hypothetical protein PHYSODRAFT_353072 [Phytophthora sojae

Sequence
1637 bases(100 bases per row)
CCGAGGCGAGGCGCAGCTTTGCAGCGCTACCGTCGCCTCCAGGATCCAACGATGGACACATGAGCGATGGCTCCTGTGTTGAAGTTTAGATGGACAAGAA
GAGGACGATAGATGGACAATGAGAAGAGGACGATGTACGGTAGCGTCCGCAAAGCCCGTTATTTATCCACATTAAAAAAAAATGGATTCGTTTGCGAGAT
TCCTGCCCTGCCCTGGCAGTCCATTTCACTGCCGAAACCACAAAAGCCGCCATCGCAAACTTCCACCAGTTCCACAGGAACTATGTCGAGCTGCACGAGG
TAAATTGCGGAAGCGTCAGTTATTTTACTGCAGGCTGGTCAAATTCATCATTGAGCTATTTTTGGTTTGATCAGTAACCGTCGTAATCAACCTGGGTTAC
ATTCCGAGATAACCAGGTTACAGCTGGATCTTTGACATCTGCACGAGACATGCCTAATGAAAACAAGTCATTCCGCCTCCTTCCACAGGAAATGCGCTGC
GCTTGGTGTAGTAATGCCCCTTCGACGCGCGCTGTGTGCCATCGGCCATCGACCACCGGCCATCGATATGCAGGATTTCCTTGAGCGCGCATGAAAGGCA
TGCTGTGCGCCAACGCATCCCTATTGCACGTCAACAACGCTCGGCGTCGCAGCCGCTTTGAGTCGGTTAATTAGGCCATCAACAGCCTGAATTTCGGCCA
GTGAAAACGCCGCCTTCATGTTTCAGAGCAACACCCTATCCCCCCTCGACATTCTGCAATTCCCCTTCCCAACAACGAAACTGGGCGCGTCGAGGGCGAG
GCGACGCGAGATCTCGGGACAATAGCAGCGTAGGACAGACGGACAGAATGCGCGCGCCGTCGAGACTTTTGCTGCCGCTCGTGGTGGCGGCCGTGCAGGT
GCAGGGCGCGGAGGCCGCCAACGGGTCGCTGCCCACGTGGCTGGCCTACGTGACGGGCGGCCTGCTGGTCATCATCATCGTGTACTACTGCTGCCGCCGC
GCGCGCTTCGACGAGAACCTACAGCAGCCGCTGCTGGGCGGACAGTACACGGAGGACGGACAGCCCATGACACGCCAGGACGTGCAGGAGTCGCACGACG
AGGTGAGCACCCAGTGGCAGTGCGAGGTGTGCGACTTCCACAACAAGAGCTCGGCCAAGGCCTGCGTGCTCTGCGGCACGGAGCGCGGCTTCAGCCTCGG
CCTCAAGTCGCCCGCGCGAGCCGCGCACACAGAGCCCGTGGCCGTCGAGACGGACGTCCCGAGGGAGAAAAGCTTCAACCGCACGCGCTCGTTCGCCATC
CGCCGCCTCAACATGCTCAACTCGCGCCAACGAGGCGCTAGGAACCGCCAGGACTGGGTGCGTAAGGTCGGACTCGACGGGAAGCGCTACTGGGCCAAGC
GGGAGCTGCCCTTCCCGCTGGGCAACGCCAAGCCCAAGGACGACGCTGAAGGGATTGAAAGCAAGATTAACGCTATCCGGATCGACGTTCCGGCCTCGGA
CGCCGACATGCTGTCGCCCAAGGCGACCACGGCGTCCACGACGTCGTCATCAATTGCTGCGGATCCGGATAAGGAGCTGGTGCACCAGCAGTCGCTGGCT
TTCGTGTCGCAACTGGCGCAGACCCCCCGCCACCCGG