Description :
From Genome Similarity Track
Location :
Scaffold_63:71690- 76174
Transcript NameFunction/comments
Physo_138391glucanosyltransferase GEL-1
Physo_138392hypothetical protein
Physo_138393hypothetical protein

Sequence
4484 bases(100 bases per row)
CTCCCCCTCCTGCTGGCGTCGCTGCCGCTCACGAGCGCGTGGCTGCCGCCGATCGTGGCAAAAGGCAACAAACTCTTCGACGCGGAGACGGGGCTGGAAT
TCCGCATCAAAGGTTTGGCGTTGATATCGATTCGTGTATCACTCCCCTCGACCTAACTGCAGCGGATGAATCCCTGTTGGCAGGCATGGCGTACTACCCG
CGGCCAAACAGCGGCGAGCTGGCCGACGTGAGCAACTACGACTGGGCGTCGGACGACCACGAAGACGTGTGGGCGCCCCACCTCGAGGTCATGCAGGACC
TGGGCGTCAACACCATCCGCCTCTACTCGGTGGACCCGAGCAGGTCGCACGACAAGTTCATGTGCGCCTGCTCGCAGGCCGGCATCTACGTGTCGGTGGG
CATGGCCGCGCCCTGCAAAGGCTGCTCCGTGGCCGACGTGGCCGCGCCGGACTGCTACCCGGACGGCATGTTCACGCGCATGCAGATGGTGTACAACGCC
TTCGCCGTGTACGACAACACTCTGCTCTTCAGTGTGGCCAACGAGCCCAACCTCATCTCGGTGGACGGAGACACGGGCGAGTCGGTCATGCCCTGCGTCA
AGGCCATGATCCGAGACATCCGAGCCTACGCGGACGGATGCGTCGGCAGCTTGAGGGAAGTCCCCATTGGGGTGGAAATGGCGGATATCCCGCCCAGAGC
TCAGTGGCTGCAGTACTTCGACTGCACGGCTAGCAACGGCAGCTCCAGTGGCAGCGGAGATTCCAGCGAGAGAGCGCAGTGGATGGGATTCAACCCGTAC
GTTGAGTGCGACCCGACCGGACACACCGAGTACTCGCAGTCCACGGGCCTGAACACGCTCATGAAGGACTACAAGGACGCGGCATACCCACGCCCCATCA
TGTTCGGAGAGTTTGGCTGCAACACGGGAGACAACACCATGGACGGATACGAGAACCAGCGCACATTCTACGATGTGCGTATTGTATTTGCTGTCTATGT
GGTTGGGGAGAGGCTGGTGGAGACTAACTCGCCGGTTGAATTTTGTTGTGTTGTTTCGTTTCACAGGCCAAGTGGATGAACGAGGAAGAAGACATGACGG
TCGAGATCGTGGGCGGCAATGTATTCGAGTTCTCGACCGAGATTGCCAATCTAGAGGGCACAAAGAGTAGGTTTGGAGGGTTTGGCGCTGGAGCATTGGT
GCGGAATCTAATGTTTGTTTGTTGTTTCGAGTAGAGCTGACGAAGAAGGCGGACAAGGGCAAGTACGGCGTGGGCTACTTCCAGCCCGACAATTGTGACA
ACGAGAACACAACGTGCGAGTTCACGCCTTACCCTGAATACGACAACCTCAAGGAGGCCTACACGACCACCAAGAACTCGACTATCGAGATGGATTCGTT
CACGCCTGCGAGGACTTCTGCGCTCAAGTGTCCGTCTGCCCTCTCGATGGACCTCCCGGACACGCCCGATGGTAAGTATCTGCATCGCGCGAGGCTACAG
TCCAAGCATTCGCTAACAACTTGACTATTGTGCTGAGCAGTCGAAAAGCTGTCTTGCTCTGTGGCGCAGCCTGTATGCGACGGCCAGAAGTCCAACAACT
TTGACTCGAGCACCTTGGCCGACCTCAACGACGGCAAGACAGCGAGCAGCGGGTCGTCGACGGCTACGAAGGACGGAAGCAGCGATGCTCACACCGTCGT
AGCCGCATCCGTCGAGGCACTGGCCCTCGTTCTCGCTGCCTTCCTGGCGCTGAGCTAAGTTCCCAGCTCCGATCTTTCATTGTGTAGCGATGCAGGACGC
GTTTCACGTCACTATATATTAGTTGCTAATGAACGGAAGTAGATGTGAACGACAAAAAGTCCCATGCAGCCAGCTCCCGTTGCCTAGGGGAAATTGGACT
CCATGTCCCCGCTGCTAACGGCAGCTTCGCGGCGCTCACCGAATACGTAGTGCCCCGCCACGTAGCCTGCAACGACCCAGAGTAGCAGCGTCAAGTCGTA
CGTCATGGACACGAGCATGAGCATGTACGCCACTAGGAGCGTCACGCCGTGCAGCAAGCTGTGCACGCCGTGCTGCGTCTCCGGCGACAGCATTCGGAAC
CACGCAGGACCGCACGAATCGGCCAGCGGCATGCTCTGCGCCGTCGACCGCAGCAGCTGCGCGCTCTCCGTCGCGTGAGGCGCGTTGCTACTGAGCAGAC
GCTTGACGCTGCTCTCCTTACGCAGCACGCGGCGCAGCTGCAGCAGATACTCATTGAACACCGCCACCAGCGCCACCAGAATACCACCGAAGATGTAGCG
CACGCGCGAGTCCAGCACCCACCCGGGGAACCACAACAAGATGCACGGCGTGGAACTGCCGCTGAAGGAGAAGCCGTTGAGCATGGTCGTGCCAGGCCCC
GAGCAGAACCCGCGCTCTTGTCCAGCGGTAGCAGCGGCGGCGGCGCCTTCCTTGGCGGCTTGGAACGACAGAATATCGCTGTAAACCTCGCGCGCGTGGG
TCATACTACACGTGTGCACTGCTTGCTCTCCGTGCATCATCAGCACCTCGGGTCCGCTGGACACTGACGACTCCATGCCGCACACTGGACACAGCACGCT
CCCCTCGCTCTCGTCGTGGCGGTGGTCGTGTGATGTCGGGGGAGACGCCGCGCCCTTCAGCCCCAGTTTCTGCAGGAACAATAAGGAAGGATAAGAGGAG
AGAGTTAGGACTCTGCTCCGTGTGTACGTCTCCGCGTGCGGTGCAGGACGTACCGGGTCCTTGAGGAAGGCGTCGAGCGAGTCCTGGCTCGCGAAGCGCA
GCTTCTGGCCGTTCTTGAGCTGGAAGTTGTAGGCCTGGCTCATGACCATCTCGCCACTCACCGGGTCGTCCTGCAGAGCGAAGAAAGCAGCAGGTTAGAG
GTGGATTGCTGCTGCGGTTGATGCAGGTGGTTGATGCACGCGCACCGGCATGTCGTCCATGTCCATGGCGGAGGCGGCGCGCGCCACCCCGTGCAGCGCC
AGAGTAGCCACCAGCAGCAACGCGAGGAGAGGTGAGAGGCGGCGGCGGAGTGTCCCGGTCATGGTGTGGGCGAGCGGAAGCGGGTCTGGGGCTGTGCGGC
CGCAAGCAAAAGCTCTTCGCGTCTTGCTCTTGATGGTGCAGCTTCTCGACTGACGCTGACGACTGGAAAACGGGAATGACAGGGACGCGAGACTTGATAT
GTAATGCGACGAGTGAAGTATGGAAGTTCACCTTTCAAACAGCATATTAGGTGATTGTTGACTCGTTCAAGAGTGCTCGACGAGTTTACCAGCCTAAACT
TTAGGCTAAAGCGGCTTGCCCGCCTCAACAACACTCCCCGGTAGAGTTAGACCTAGCTAGTCTTGCCTACTCTAGCGTTGGCTGCGTTCACATTGGGCCA
ACAGGATCTACATTGATGCAGACTGAACTTGGTATTTATTGTTGATGTGCCAATCCAACTGTTGCAAGTCTGTCGGGAGAGATACCGCTTAGGTGAGCTT
CGCTTGGGCTGCCCAAGTTGGGCATTGCTTGTGTTTTTTTACAGTACTAAAGTATCGAGGTTGCTTGCAAAATCTGCAGGTTTTGTTTCTTACAGAACAT
GCACGTGTATGGTAACTTAGTTCTCGTGGAAATGCTTCATAGTTTTGCCCTTGCAGGTACAGTGAACAAGGAAGACTTACACGATAGTTTTCTTCCTCAT
CTTTTAAAAAATTCAACAACTTCGATGTTCATGCAATGGTTTACCATGTTCCCACTAAACGTGTATTCGGTGCTACTACACTGTTCTCGAGTAGCTCGGT
TGCTTCTGCACTGCAGTCAAGCGTAGTGTGCAGTGTGTTCGCTTTTCATTCTGTGTTCGTGCTACAATTTGCAGCCTGCAAATTGCGAGGTTGCAAACGT
TCTGCAGCAAGACTGGGAGCTACAACTCTCTCTACCCTCACCGTCCGTTGTCTTCTTAGCGCTATCACTTGCATACCATCGATCTCGAACAACAACACGG
AACGCGATCGCTCTCAGAGCACCCACCTCTCGGTTTGGCTCTCGCATTTGAACCGTCAAAACGCAATTTTTTCTTATAAATCCGCCCTTTTATGCCGCGT
ATCTCATGTGTGCAGCGCAGCCCCAGTTGCCGTCTTACCCGGCTCGATCAAAGAGCTCATTGCTTCACTTCGCCAGCTACGATGGAGCACGGCGGCTTCT
GCATGGGCCCGGGCTCGCTCATGGGCACGGCCGGCTTCAAGTGGGCGGGGCGCGACCCCATGGCGGACTGCTCCATGCTGTGGCTCGAGAGCTGGGGGCT
CACGAGCGTCTCGCGCGCCGCCGCGGCCTGCATGCTCGTATTCCTGCTGGCCGCACTGTCCCAGTACCTGACGACGGCCAACGAGTGCCAGCTGCAGCAG
TCCAAGAACTTCGCCAAGCGCCGGCTCGCCAAGGTGCTGACACAGCACACAACCAGCAGCAGCAGCAATGCAGCAGGCGGAAGC