Description :
From Genome Similarity Track
Location :
Scaffold_1257:7169- 11886
Transcript NameFunction/comments
Phypl_g12919hypothetical protein

Sequence
4717 bases(100 bases per row)
AGGTTTTCCTTGTAAGACACAAGTGCCTTTGGATTCCGGGCTGGGAAGTATATTGGCCCtcccgacgaccaagacggcaCCAAGTCCctcacggagaaga
cgccgaagacTCCTGGATTACTTGGCcaggccgccaccttctctccACTCAAAGATCCCGCCaacaggaagcggcaagcacgGAAAGGAACCCCCAAGGA
CACCCCCACGAGTGGATTAAGGCACATCCAAGACCCTGATCGGCTCCACTCGACGGCCAagtgaagatttccacgcggCTGTGAACAACAATCCCCCAAA
TATCGTCCACACAAGCTCAACTCAAGATCGCACagacgtcttcgccgtcaccggaAGATCGTAACCCGCCCAACCAACGGGTACACACGGTGAGAGGACT
TCAGTCCCCACAGACGaacggagtaccccctccgtaaATTGGTAGTCTGGGCAACCGTTGGCTAGCTTGGATCGTGTTAGCAAATTCGAGattcctgctc
cgccacaatggtgcgcgtgctcggATCTTCTGGTGACTCTGGATTTCACCGTGAGTCCACCGAAGAAGATGTCAAGATCAAGGTTGAGCCAGGGATTGGT
GAGTCAATGAAAGGTGaatcgccgtcgtcgctgctgaagagcgaAGGATACACCAATCGTCAGAGCCCTGGGaggagctccgacgacgtAAAGGAGGAAG
GTTCAGAGATGGacctcgaggagaagcctccatcttctcccCAGGTCGCTTCGGGGACCGCCGCGGGTCGCGACAACATTCGCGATCCGCACGATGGAGA
TCCGTCGGTTTTCACCGACGGATCTTCATCTATCCCCACTCCTCCAGCCTCGCGCGCGaccttgaagaagaagaccccGCGTATGAACCTGAAGGCCCCG
GAGTCCGTCTCTGAAGATCGCACTGGGCTTGAGGGCTGGACCGACAATCAGCTTGAAGCAGTCTCCTACCGAAATAGACTGTACGCGTTGCTGGTCAAGG
ATCCGGTTCTGAAGATTATGTGTCTGAAGCTGATCGGGGATCTCGGAGGACCTGTAACCGCACCCAGGGAAGTGCTcaacaagctggacgcggtgaaGCT
CCTGATGCGCATGCTGAAGGAAGCTGGGATCGTGCCAGGAGCGTTCGACGCGAACGAGTTGTACGATCTGGAACTGACCGCGATCACAAAGGCGACGCTC
GCTCTCTTTGAGAAGCTGGCTGCTCTGGTCGGAGTAGTCCCGCCGGCTGCAATGATGATGGCACCGCGCAGCGGTTCATCGCAGTACGCGTCAGCTACGT
CGGGTGCTGCATCCAACAGTTCGATCGAGGTGAAGAGGATGACGCTGGGACCAGCCGGCGCCACCATGCTGGAAACTCGGAAGAAGGGGGCGAAGCTGGC
CTCGCCGCCGGCCGCGCCATTAACCTCCGCGACGCTAGCCACAGGCCAGGACTCGCCAGATTGCATGCAGACGTTCTTCAATGCTGCGATATCTCGATTC
TTAAAGGAGCAGCAACCGGATCGGATACCACTACCTCGCGAGCTGCGACAAGATCGTGTGCCACCGCCGCGTGAGCAGCCACAGTCGCCCGTGAAGCCGA
AGCAGATCGACACGCCAGACGTTGAGATGATTTCTGTCGGATCCGATCATGATCCACCTCCAGCGGATGAATACGATCCGGATGATTTGAGTGTCGGCAG
GCCTCGACGTGCTGTGGTGGCGACCGCAGAAGCAACAACTGGGGGCGCCAGTTCGGCCGCACGAATTCGAGTGTCCGCGATCTCGAAACTGAAGGAGTTC
TCGGGGAAGAACAACGACGAAGATcgcgccaggagctggctCGGCAAAGTCAAGTCGGCGTTCATCCGTGATCAGGCTACAGACAGCGAGAAGTGCTTGG
TTTTTGGTGACCTGTTCACGGGACCAGCTCGCAACTGGTACCGACAGTTGAGTCGGAtgacgtggagcagctggaagagtcTGTTGGAAGATTTCCTGAC
CCAATATTGCGGACGTGGAGTGTCTGACGCGAGACAGTACTACCACGCGAGGAAGCAATCTGAGCAATCACCGCttgagcatctccaccggcTGAACGTT
GCTGGAATGCGAGCGAAACTTCAGAGCAAGGATGGATCGCCGGATGCCCGCCGGGAACACGTCAAACACTTCATTGAGAAGTTGGACGATCGTGATCCGG
CGGATCAGCTGGCGCTACTGATGATCGCCGAAGCGGTCCATCTCGAAAATACGCTGCGTGCACGCTAGCGCGCCAAGACCCGCCAAGGAAAGGCAGCGGT
CGGATCGAGCAAGTTCAGTTAGAAGGCTGCACCTCCAACGCATCCGGCTCCCTTGAAATCTGCCCGCGCGGATCGAGCGATACGAACGAAGGAAGACCTC
AacgagtccgagtcggaaGCCAGCGGATCGGAACCAGAAGGCGATCTGCGCCCGCTCTACCTCGCCGCGAAGGCCGATCGTCAGGATCAAGGCAACTGGC
AGCGACCACGCCCAGGCGCGGTGGGGCCGCAGGATCGATCGGACCCGAACTTTCCGTCGAAGCAACGTTCCCACTGCGGATCCAGGAAGCATGACGACTt
gaactgctggaagagacTGACTTGCGAGAAGTGCGGCAGGAAGGGTCATCCATCGGATCACTGCCTCTTCATGTGTCATGCCTGTGGCAAACTGCATGAT
GCCGGCAAGTGCCTGATGGAGGAGTTCTACAACTTGATCCGCCAGTGGTACAACCCCAGCAGACATGCCGGGATGTTGCCAGTCAACGCGGAGAAGATGT
TAAACTAGGACGCTCGTCGGGTTTGAATCCTATTCGAGCCGAGCGTTCTAGGTATTGCATTTTTGCATTCATGGACAAAAAACCGGTGGATCAAGTTAGC
AAGCGGCCAGATCTACACGGTACTACATGTGACCTGCATGAGAAACGTACCGTGAAGATCTCAAGTCTGCGGCTGGATGATGAGTTCTCCAGGTCCGACG
TCAAGGTAGCTTTGGATCTCCAACTcggagaagagcgaggtTACTGGAAGCAGCGGGATCCGGAGCAGTGGTTCGCACctgccaagaaggaggacacGTC
GGGAAGCCCAAGCATTCGACGTGTCAAGGCGGCTTGGCGATCCGGGGGCGGGACGCTTCCTGATCTGCAGCCCGGGGAATCGCGGGGGTACTGGAAGTAT
CATGTCCCTGGGAAGGGGTTCAAGCAAGCCAAAGCCATCACCAAAGTGAACAATAAGAAAGCCACGTTGCTCTTCGACATCGGCGCTGAAGTCTCAACTA
TAGACACCACCTTTGCTCGTAAGGTTGGGTGTGGCANGGCGCTGAAGTCTCAACTATAGACACCACCTTTGCTCGTAAGGTTGGGTGTGTCACAAACGAA
AGTCAAAGACAAAAGTGCGTCGGAATCGGAGCGAACACATACATGACGGTTGGACGTACCACGATCAAGGTCACGCTGGCTGGATCGTTAGTGTAGTACT
TCGATACTTGGGTTGCCGATCAGTCGGGGCAGGAAGCGATACTCGGTATGGACTTCATGGTACCCGCTGGAGTGCGCCTCGATCTAGCTGATGGGACGTT
CTGTCTCCCTAATGAGGTGCTGATTCAGCTGCTAGGACGGCGTCAGCTGTACGGAGCTAATGTCCAGCCCGTCACGCTTGATCAAGATCTTGAAGTGCCA
GTCGCCGAGTCCGTGGAGATCCCGATCCGGTATGGCCGATCGGCCACAGCAAGGCTCTGGATCACACGAGGTCCAAGATGGGTACCGACCGCTGTCAAGG
GTCTGGGCCGGACGAGGCATCTGCGGATCACAAACGTGAGTAAAGAGATGTTAGTACTTGATCGACACGAACGTTTGGGAATCTCGCTAGCCCCAGACAC
CGTACCTCGCATGCCGGGGTTTGTGTCAGTCGGATCGCGCAGATACGCTGAATGGCAGAACCTTGCGTTCGAGGCTACCACTAAGCGACAGGAGGAACCA
ggacgcgaagaagagccAGTGGAACCGCTGATGGATCGGCCTCGATatccgacgccgacgcgaaTTCTGAGTCGGTCTGATGGGCCTCCTAAACCAGTGA
TGGCCGCAGGAACAGCCTTACCATCGACCTGCGAAGGAACACGGGAAGGCCTGCCGAAAGCCGAAGTGAAGTGTGAAGAGCcggacgaagagcgagtCGC
CCGGGAGCCTGCATCGATCCAGAAAAAGGAGTCGAGCTCGGAAGAAGCTATAGTAGAACAGGTCTGCTACCATGAGGGCGGATGCTTTGTCGAAGAAGAT
CTCGATCGGGACTTGGCCATCTTGCCCGAGGTAGCGGCTTCGACCGAAGACGTAACGATCGAAGACATTCAGGTTCGCGATCCGATCTGAATACCCCGGA
AGAGATCGATCGGCTGCGATGGATCATctggcgaaggcggcacCTGCTGATCGGCAAAAGGAACGCCCTGCCACCTGCGGCACGCGGTGCAGTGTGCGAG
ATCGAAGTTGGTGGTGCCACTCCAGTAGCCCAGCGTGTGCGACCAGTTGCTCCACAATTCGAGAGAAGTTGGCTGCGCTGATCAAGGGCTTGGTGTCGGC
TAGGATCATCAAACACTTGACCTCACCGTGGGCATCCCCGATCGTGATCATCATCAAGAAGAATGGTGTTGATATACGACTCTGCATCGATTACAGAGTC
GTCAACGGCCTGACGCG