Description :
From Genome Similarity Track
Location :
Scaffold_106:71684- 73562
Transcript NameFunction/comments
g9476.t1OWZ19001.1 hypothetical protein PHMEG_0006807 [Phytophthora megakarya

Sequence
1878 bases(100 bases per row)
TCCGGCAGCTCCTGCAAGTCCCCAAATGCGCTACTCAGACACTGCAGTAAGGTATGTACCTCCCGATGAGAACCGAATCGAGCCGCGTAGTGAGCGGGCG
TCTCTAACTTTACTGTGGTAGCCGTGAGGTTGGTACCCTCTGGATCCATGTCGGCAAGCAGCTCCATTATCGACGGGTTTTGTCGCAAGATAGCCAGGTG
CATAGGCGTCTCGCCCTTGGCGTTGCGCGCAGTCACAGCGGCGTAGTCGTTATCCACAATGAAGCGAATCACCTCCTCCACTTGACTGTCCACCGCTTGT
AGCAGTACCGCGCCTCCAAAATCTTGTCGTTGCGGCGTGACATCCCACTGATAGTGGTTCATAAAGAGCTGCAGCACATTCAAGTTCGCTCGTTGCACAA
CCAGGACCAACGCCGTGGTACCGCTCGTGTCTTCTGAATCAATAGTTGCTCCGCGCGACAGTAGCAATTCCGACACGAGCAATCCTCCCTCCTGAACACA
ATAGTGCAGTGGCGTCTTTCCGTTCTGGCACCGACGCAGGAAAACCACAGTTAGTCGACCACAATCAGATTTTCATCAGCCCGTCGTTGCAAAACGGACC
TCGTCCTGGGCGTCTACGCTTGCGCCGGCATCAAGCAAAACCTTGGCCACCTCGTACGCATCGTTGCTGGTGGCGTAGTGCAGCGCCACCTTGCCATCCT
GTTACAATAGTACGAACATATGAGCTTGATCCATCAGATAACAGGATTCACCATCTCTCGCTACATGTGGCTACGCGTACCTGGCTGCGTGCGTTCACAT
CAGCACCGAACTGGAGCAGCAGACCGATTACCGCGACCACCTGCTTCTGTTGTTCATCCTCCTCTTCACGACACTGCCGGTAGTATTAGTCACAAAACTA
TGAACCTTCCGTACCAGCACCAAGAGGGCAAGTGTACAATGCCATACTCACATCCACGAGGATGTTGCGGCGGATAGCTTCGCCACCACGAATCACGCAC
CGCATGGTCATGATGGTAAGGCGCAGGATGGCCACCATGATTGGTGTGACCGCGGCCTCATCGCCCGTGTCAGGGTTTTGGCCCTCTTCCAGCAGGAACT
GCACAATTCCAAGGTCTCCGTTCCACGCTGCGGTATGGAGTGTCGAGGCTCCAATTGTGCGCAGATGGAAGTTGGTCCAGCTGCAGGATCGAGGTCGGTA
TGACGTGTCTTGTGTAGGGGAACCCACGGACTGTGGATTAAACATTTCGCTGTCAGAAAGAGTAATAAGGCGTCCAGCGCCGGGTTTTGCGTCATGATAC
TTACCCGTTGCAAGTCCAGCCATTCGGGGAACTGGCGTCGGAGTCCACACATGGTGGCAACGTCTCCGTTGGCACCAGCAGTGAGCCACGCTGCATGGAC
TTCCGCTATGCTACTCAAAGATGGTAGCGGCCCTGGGACCTCAGCAGAATGACTCGCATTGGTTGACTCCATCGACTCCCCCTTCTTCCGGAACAAATTG
CCACTGAGCTCGATGCTGCTCAGTGGGACTCGGTCGCACTCGCAGCTTTTGCTCGGTGGTGATTGGACGAAGCACCCCAAATATTGTCGTATATCCGGAG
AGCAGAAGAGGACGTTCATGAATTTTAGCTGGATTTGAATCTATTTGTGAAACCAGTTTCACTGTTGCAGCAACAATTTACTGATTCTGGCGGAAGGCAA
TCAGCAAGTTGCAAGAGCCCACCACAGCATGGCTCACAATGGAAGTGGCTTAAACGATTTGCAAATGAGTCAGCAGTCACCACGAAGAGGCTGCTGCGAC
ATCAGCGAGAATCTGGCGTGCGCTGAAGCGTTGCTGCGCTGTAGCAACCCCGATTTCGACGCCCTGCCCCAGAAGAGA