Description :
From Genome Similarity Track
Location :
Scaffold_729:7166- 9992
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_729-fgenesh-gene-0.5TPR repeat-containing protein

Sequence
2826 bases(100 bases per row)
GAAGCCATCGTGGAAGAGCTTTTTCAAGTCGAACGGCGCGTAATTGAACACCGGGAGATACCCCTGGTAAGCCAGCGAGAACTCGTACATGAACTTCGTC
AAGAGCTGCAGGATCGGCGTGAACACTTTGGTCGGCGGCCNNNNNNNNNNNNNNGTGCGCTTTTGTACCATTCCTCGACGCTTTTACTGTATTCCTTGAC
GATGTCAAACGGCACGGCATACACGCGCGGGTCGGTAGAGGCTGTTGCGAGCTTGTCGGACGGATTATTGTAGATTAGCAAGGGGCCGTCCGTGAGTGTT
TTCCAATACCCAAAGAGCTCGTTCTTATAATTCGCAGTGTACAGTAACTGGAACATCGGCAAGTTGACGAGCACGTTGCGCAGTGCGTCCCACTGGTAGC
ATCGTTTCAGGTGCCACGGGAGCTCTTCGACGCGACGAAATGTCGTCGGGTGGATGCGGAAGAATCGGATCATCCACTGATGGTACTTTTGCTCAACGCG
CTCGCTTCCGATGTACCGCCACCAGACAACTTCGCGCAGGATCTCCTTGCAGATCGGCAACACAATCACGTCCTGGACAAACAGAATGCCGAGTGGCTTC
ATCGCACGAAGCAGCATTTTCCACTGGGCCTCCGAGAACCCCGTGAGGCTCTGGTGGTCCATGTTTTTCACGCTGCCAAACGACGTCTTGTGGTGTAGCT
GATTCTTTTCCTTGGCAGCGTCGCGCTCTTCGGTCACGATCGCGTTCAAGATGAACCGCAACTCGTTTGTGAGCAAACCGTGGCGACATACGTAGAGCAG
GCAAAGCGCTCGGCTCAGCAGCGGCTCCAATGGAGCGACAACGCGTCCACCAGTGAGGTATGCAGGCAAACCACTACCTTCTCCACCTCCTGCGTTTGTC
GTTGACCGTGGAACACGCATAGTTTGAGAGTGATGGATTGGTGCCGCGCCAGCTTGTCGTGGATGCATGTAATTCAAGCGAACGACTGCGCCTCCAGCTT
GTGGTGCAGGGGCTGCTGTTGCATTCAGGCGTGCTGGGAGAGCGCTGGCATTGGATTGTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTACAAACACTTCCTTCATTTCGTGGACACTTTCCATGCGCGT
TGGCGATTCGGGTGATATGCTATCATCACTGGTACGCGTCAACATCAAGGGCGATGACGATCTGCGGTACTGCATCTCGTCATACCGGAGCTCGATCACA
GATGACGTCGTGACCGTTTTGTTCTCCGATAAGAACGCGGGGATAATGCTCGGGATGCGCGAGTCGTAGTAGCTGAACTCCTGAAGGCGCTGGTCGCTTG
CTGCTCCTCCTGGTCCAGTTGTGAGCCGACTGCTGGCATCACCCGAGCCACTTTTCGCGTCGGCAAACCACAGCGTCTTTTCTGCAGTCGCTACTATCGT
GTCGGAGGCTTTCCGACGGAGTGGCACAACGTGCTGTGCCTCGTAGGCTGCTTTGTTGAAATTGTTCTCGACGAGAAACTGGTTGGCGTCGGCGGTTCCT
TGCGGATCAGGCGTAAAACCCGTTTCCATGCTGCGGAGGACTGCTTCCATGAGCTGACCATTGCTCTCAGCACTGAGCCAGTGCTCAAATACGACGTGAA
TATTGAAACCTTCGTCGACCGCCCAGGCCATGGACGCAAGGAAGAGTTTGAGGAAATGCGGGTTTGCGCTCATAGGCACTGATACGAGCGCCCTTTGCTG
GATCTCAAAGAGCTGTAGCCCAAGGACCTCGCTGTGAGGGCTGGGATGTATGCCGCCATTGGCGGTATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCGCTCTGAAATGCTGTGCGTTGGGTGGTACTTGTGCATAAACTTCTTCACGACCCGACGGCGATCGTCTTCTGCGAGCGGAGGGACATGCACCGAAATC
CAGTTTCGGCGATTCGCTTCCAGCTACAAGCGCGCAAGAACAAACAGCAACATTCACACGCACACATATGTGAGTGTCTCGAATGGCGTGATGCCAGATA
AAGGTTACTGCTGCAACGAGCGTACCTTGATGCGCTCAATCATCTGCGCGTTCAGGTTCGCTTTCTCGTGGTGCTCACTGCTTACGACGTCGATTGAGTG
GCTTCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTCGTCGTCGGGTAATTGATCGTGCCCGAAAAGACGATGCGCACAT
TGGGCGGGAACGCGAGCGGAACCCATTTCAAGATACTTTCGCCGTCGCTTGTGCGCAACCGCTGCAGTCCGTCGATGATCAGGATCACGCGGCCTTTCTT
CGACGCAGCCTCGAGGAATCGTGGGAATTGCCAGCCCAAGCGCTCGTCGACGTCTGGGATCTCCTTGTTCAGTTCAAAATACTCTTTAATTTCGCGGAGG
ATGCGCTCCAGCAGGTTCGACACGTAGCACGATTGCCGCGAGCACCCAACGACGTGGTAGAAGATGAACTCCGGGTACGATGTTTGCCAGTTTTGAAACA
TCTTCTTGCGCCGTACAAGCCAATTCGCGAAAAATGTGCTCTTACCGACGCCGCTTTCGCCTAGGAAGATGATTGGACCTTTGGGGTGGTGCATCGCGTC
GACGTCGCAGAACTCGTCGAGCTCGCGCGTCAACCGCGTGTTCTCGTGATACACAAAGCTACCGGCCTTCTGGCGACTGCGCATGAAGCCATGATGGAAC
GCACTTTCCAGGTACGAGATCGAGTC