Description :
From Genome Similarity Track
Location :
Scaffold_639:7166- 9728
Transcript NameFunction/comments
Phypl_g9995hypothetical protein PHYSODRAFT_318067

Sequence
2562 bases(100 bases per row)
gcaagcttcTTGAGGTAGCGCTGGCGCTCGGTGTGCATGCGGCAGTAAGCCTGGAATCGCACGATGCAGTAGTCGAACTTGAGCACGCGGTACATCTTGC
GAGCCGCATTaccacgagcttgagcctgcagcagcacgacacCTCGGCGCAGAGTCAAGTATCGCTTGTGCACCACGTAGCGGCGCCAGTATTTCTGAAT
GGCCACAATCTGTTGCTTCTGCCGCAGGAAGTGGCGGCGCATAAGCCAGCAGCGCACATTCTTCTGCAGGACAATTGCGTATTTGCGCAGAGCCCACCCG
CGCTTAgtctccagctcttccagaACACCTTCGCGGAAGTACACACGGGTCAGACCCACCTGGTAGTCCTGAATGTTGCGTCCTGGcaacagcttctcca
tcaacTCTTCGCACTGCGTCTTGATGTgctccgagtccgagtcaCTGATAAACTTGTTTTGCGTCGGAACCGCGCCAGTAACCAGCACGCGGAACTTCTT
GATGCACTCCAGGTGTGGCATACGACTGGGGTACGCGCTCCGAGACACACGAATGGCCTCAATGACACCAGCGCAACGCAGCTGACTCACGATGTCGCCG
TGTGCGAAGCAGTTAGCACTCTTCAGCGGGTTTGGTTTTAGACAACGCACATAATGCACCTCCGTGAGTCcgatcttctccatgagCTGCGACAGACTCT
CCTTGAACTGTGTGCCGACCGTAGTTCGGCGTGTTTGGGCATGGCCTCCCTTCTTAGTACTGCTGCTACGCGCTCTGCCCCGAGCATTTGGTGCGCTGCT
accagcactgctggcgTTCACATCATCCGTAAACATCTTGGACAAGATTTTGAGCTTGGACTTGCTCATGCACTGCTTGATGTCCGGCAAGATGGCGTCG
CGGTGCTTGTCGAGGAAGCCCGACGCGTCGTAGGTCACCTTACCAGCGTAGTGGTAGACGGAGAAAGCGCACTTGTTCAGACGAGGGGTCTCCAGTAGCG
GGTTGTTCTCCATCACAGCACCCAGCTTGCTTGCAAACGACGCGTCCGTGCCCGTGGCAAGCAGCGACTCCTCAttcaagaagctgatgacGCCCAAGCG
GCCTTCGATGAGATTCAGCACGTCCTGGTTGTCTGCGAATGTAATGTGCGACCACGAAATGTTCTCCTCTTCGTACTCGATCTGCACCGTCTTAAGCACG
TCCTGCACGAacttctgctggagcttctcgttGGCGTAGTTAATACAGAATTGCTCGAACGAGTTGGTCTCGAAGTGCTCGAAGCCAAAGATATCAAGAA
TGCCAATAAACGAGCCGGCACCCTTCGTCTTCACGCCAATCGTCTGGTTAATCTGCTCCACGAGCCACAGGAAAAGCTTCGAGTACAGGCTCTTGGCCAG
CGCATCTCGACAATCCGCAGCCTGGTCGTGCGTCATCGGCTTCAGAATCACTTCACGACCCACAAACACGTTACGGTTGCACACAGCGCGCTCCAGTGCG
TCGACCTCGACGCCCAGAAGTCGACAGGCCACAGTGAAATGCTTCAGGTCCACCAACTGCGAGGCGTCCACATCTCCATTCCGTGTGGTGAACGCCGTCT
CACCCAAATGCAGCACAGCGCCCAAAATCTGGATAATttcctcctgcagcggctgTTCGATGCCGacaagctccagcgcctctCGCGTGCGACTGAggtc
gccttcttcgtcgccgccggGGGCTTCCGCCCGCTCCGACACGTACCTGAACGAGTCCACCatgtcgagctcgagctccggGAACTGCTTGCGCTGAGCC
AGCAACTGGTAGAAGATGTGGAAATTGCGTTCTCCGTCCGCCTGCGTCGTGACGCGACTCTTTTCCAGCAGATACGTGCGCGACCTGGCACCGATCAACT
GTCCTTCAATAGTGAACTGGAGCTCCGTGAACTTGCCGAAACGACTCGAGTTGTCATTGCGCACGGTCTTGGCATTGCCGAAGGACTCGAGGAGCGGATT
GGCCTGGATGATCTGCTGGATGACCTTCGAGTTGGTGTTCGTGGCCAGGGCCGCCAAGTGGCTCATGACAATCTTTGTCGTCTCAGTTTTGCCAGCTCCT
GACTCACCTGACACCAAAATGCTCTggttctcctgcttctgTCTCATGTTGAAAAAGGCCTCCATGGACACGGCGTAGACGTGCGGGGGCTTGTTCTCgc
gcttgccgtcgctgaATTTCTCCATCGTCTGCTTGGAGTACAGATCCAGCCACTGGTACGGGTTGACGGCGATACAGATACGCCCCGTGTACGTGTCTGC
AAAAATAAGTTTAGTGGTTCGTGGATGAAAACCAGTGGCAACAATTTGTCAGTCACTTTTTGCCAATGCATAAAAAATGTTTGCCATGGCGTCAACGTAC
ATGGCAATCGGCGGAAAAACCTCTTTCTCAGGTTGTAGAGGATGGACGCCTCGTGCAAATGATCAATGAGGATCATGTCCTCGAAGCCATTGGCGCTCTC
GTTCGTgttctgcagcggcagcgacggcttgTTGTCGGCCGACTCCACCGACGTGTTCTTGG