Description :
From Genome Similarity Track
Location :
contig_23:716377- 718089
Transcript NameFunction/comments
g6165.t1hypothetical protein

Sequence
1712 bases(100 bases per row)
TACATGGAGTCGATGGCGAAGGGCAAGACGGCGGATGCACTGTCGGAGCTCGCAAAGTTGCAGCCGAAGACAGCTTTGTTGATGTCCAAGGGTAAACGCG
ACCGCGAAATCCCGATTGAGTTGGTGCAGCGAGGCGACCTACTGCGCATCCTCCCGGGCGCCAACATTCCGACTGACGGTGTGGTGATATCTGGCTCGAG
TTCGACGGACGAATCGATGCTGACTGGTGAGAGCATGCCGGTTGCTAAGAAGGAGGGTGACTACGTGTTTGGGTCGACGGTGAACCAGCAGGGCACGTTG
GTGATAGAGTCTAGCTGCATGGGCGGCGAGAGCTCGGCTTTGTCGCAAATCTGTGCTTTGATTGAAGATGCACAGCTGCACAAGGCTCCGATTCAGGCGT
ATGCAGACTGGCTGGCGTCGATCTTCGCTCCTTGCGTGCTGGGTTTGTCTGTCTTAACATTTACTACCTGGTTGTTGCTGCTGTCGATGGACGTTGTACC
TCCGCAGTGGAAGCTGGATCTCGGAGTGCCGATGGGCTCTGGCCATGCAGATGATTTCTTCTTGTCAATCCTGTTTGCGATCTCGGTTGTGGTGATAGCG
TGCCCATGCGCGCTTGGACTCGCTACGCCTACTGCCGTCATGGTTGGCTGTGGCGTCGGGGCCAAGAAGGGAGTGCTTATCAAGGGTGGCCGCGCTCTTG
AAACTGCGCGCTACATTGACACTATCGTGTTCGATAAGACCGGCACACTTACCGTTGGGCACCCTTCCGTGCGCGACGTAGTGGTGGCCGACCGCGCGTA
CACGCCGCGCGAGCTGCTGTACTATGGCGCTTCGTTGGAATGCGTCAGTGAGCACGTACTGGGCAAAGCCATCGTGATGACGGCGACGGAGCACGAGAAG
CTGGTCCTACAGGACCCGACAGAGGTGCGTGTGGTTCCCGGCCGTGGTATTGAGGGCGTGGTGGCTGCCAGCGAGGTCACGTCACGTAAAACTTCCGCAA
ATGTGCTGGTGGGTAACTCGGAGTTCTGCGAAGAGAAGGGGATCGAGATCAGCGAGAAGATGCGTGCGCACATGCACGAGCTGGAGCTAGAAGGAAAGAC
CGTAGTGGTCATATGCGTCGAGAGCAAGCTGGTGGGCGTGATTGCGTTGGCGGATGCTCCTCGTGCGGAAGCGGCGGCCGTCGTGCAGCACCTGAAGGCG
ATGGGCCTGGACGTGTGGCTGATCACGGGTGACAACCTTCGTACGGCCAGTGCGATTGCGCGGCAGATGGGCATCAACCACGTGAAGGCTGTGGCTCTGC
CCGGCGAGAAGGCGTCTCAGATCAAGGCGCTGCAGTCGCAGGTGAACCCGCTCACCCTGAGGCCGCGCGTGGTGTGCATGGTTGGTGATGGCATCAACGA
CGCGCCGGCACTGGCCCAATCGGATATCGGCATGGCAATTGGTGCTGGCACGCAGATTGCCAAGGCCGAGGCTGACATGGTTCTGGTGAAGAGCGCACTG
ACGGACGTGGTGGTGGCGTTGGACCTGGCTCGTGTGGTGTTCTCTCGCATCAAGCTGAACTTCTTCTTCTCCATCGTGTACAACTTCATCGGTATTCCGC
TGGCTGCTGGCATGTTCTTCCCGTTGATTCACCGAATGATGCCTCCTGCGTGCGCTGGATTGGCGATGGCGTTTTCGTCGGTGTCTGTGGTGATCTCGTC
GCTGTTGCTCAA