Description :
From Genome Similarity Track
Location :
contig_23:716354- 718066
Transcript NameFunction/comments
g6462.t1hypothetical protein

Sequence
1712 bases(100 bases per row)
TACATGGAGTCGATGGCGAAGGGCAAGACGGCGGATGCACTGTCGGAGCTCGCAAAGTTGCAGCCGAAGACAGCTTTGTTGATGCCCAAGGGTAAACGCG
ACCGCGAAATCCCGATTGAGTTGGTGCAGCGAGGCGACCTACTGCGCATCCTCCCGGGCGCCAACATTCCGACTGACGGTGTGGTGATATCTGGCTCGAG
TTCGACGGACGAATCGATGCTGACTGGTGAGAGCATGCCGGTTGCTAAGAAGGAGGGTGACTACGTGTTTGGGTCGACGGTGAACCAGCAGGGCACGTTG
GTGATAGAGTCTAGCTGCATGGGCGGCGAGAGCTCGGCTTTGTCGCAAATCTGTGCTTTGATTGAAGATGCACAGCTGCACAAGGCTCCGATTCAGGCGT
ATGCAGACTGGCTGGCGTCGATCTTCGCTCCTTGCGTGCTGGGTTTGTCTGTCTTAACATTTACTACCTGGTTGTTGCTGCTGTCGATGGACGTTGTACC
TCCGCAGTGGAAGCTGGATCTCGGAGTGCCGATGGGCTCTGGCCATGCAGATGATTTCTTCTTGTCAATCCTGTTTGCGATCTCGGTTGTGGTGATAGCG
TGCCCATGCGCTCTTGGACTCGCTACGCCTACTGCCGTCATGGTTGGCTGTGGCGTCGGGGCCAAGAAGGGAGTGCTTATCAAGGGTGGCCGCGCTCTTG
AAACTGCGCGCTACATTGACACTATCGTGTTCGATAAGACCGGCACACTTACCGTTGGGCACCCTTCCGTGCGCGACGTAGTGGTGGCCGACCGCGCGTA
CACGCCGCGCGAGCTGCTGTACTATGGCGCTTCGTTGGAATGCGTCAGTGAGCACGTACTGGGCAAAGCCATCGTGATGACGGCGACGGAGCACGAGAAG
CTGGTCCTACAGGACCCGACAGAGGTGCGTGTGGTTCCCGGCCGTGGTATTGAGGGCGTGGTGGCTGCCAGCGAGGTCACGTCACGTAAAACTTCCGCAA
ATGTGCTGGTGGGCAACTCGGAGTTCTGCGAAGAGAAGGGGATCGAGATCAGCGAGAAGATGCGTGCGCACATGCACGAGCTGGAGCTAGAAGGAAAGAC
CGTAGTGGTCATATGCGTCGAGAGCAAGCTGGTGGGCGTGATTGCGTTGGCGGATGCTCCTCGTGCGGAAGCGGCGGCCGTCGTGCAGCACCTGAAGGCG
ATGGGCCTGGACGTGTGGCTGATCACGGGTGACAACCTTCGTACGGCCAGTGCGATTGCGCGGCAGATGGGCATCAACCACGTGAAGGCTGTGGCTCTGC
CCGGCGAGAAGGCGTCTCAGATCAAGGCGCTGCAGTCGCAGGTGAACCCGCTCACCCTGAGGCCGCGCGTGGTGTGCATGGTTGGTGATGGCATCAACGA
CGCGCCGGCACTGGCCCAATCGGATATCGGCATGGCAATTGGTGCTGGCACGCAGATTGCCAAGGCCGAGGCTGACATGGTTCTGGTGAAGAGCGCACTG
ACGGACGTGGTGGTGGCGTTGGACCTGGCTCGTGTGGTGTTCTCTCGCATCAAGCTGAACTTCTTCTTCTCCATCGTGTACAACTTCATCGGTATTCCGC
TGGCTGCTGGCATGTTCTTCCCGTTGATTCACCGAATGATGCCTCCTGCGTGCGCTGGATTGGCGATGGCGTTTTCGTCGGTGTCTGTGGTGATCTCGTC
GCTGTTGCTCAA