Description :
From Genome Similarity Track
Location :
Scaffold_94:71630- 82301
Transcript NameFunction/comments
Physo_141099loricrin-like
Physo_141100hypothetical protein
Physo_158277hypothetical protein
Physo_141102hypothetical protein
Physo_158281hypothetical protein

Sequence
10671 bases(100 bases per row)
AGCGCAACGCTCAGTCCGCGCCACGGCACGCCGCTGGTGACATAAGGCGGCCGAGGCTCTTCTTGGAGCCCCGGCCATCCAAATGGCCGTCCAGCAGAAA
AGGGAGCATTTCGCTCGCGGAGGTGCCCGCGGCGCCGTGCACGAGCCGAGCGGCGAGACTCCGCAGAGCTCCAGAACAAGAGCGCGGCCACGGAGATGGA
GGGAGGCCGCGGGCGGCACCGCCGCGCGCGAACGAATGCGGAGGTCCTCAACCAAAGTGTCCTCCGGCATTGACGAGCGCGTGCACGAGCGCGGACGCCG
CTCGTACAGTACGGAAAGGTCCGCCACGCTGGCCACGCTGCGCCAGCCCTTCTTTGCATTCCGGAGCTCGTCACCAAGATCGCGATGACGGCAGCCGCAG
CGGAGACCGCACGCCCAAGCAGCCCTCGACCCATGCTGCTGCGCACGAGGGCAACCTGCAGTGCAGGTCCTGCACACGACGATCGCCGCCGCCGCCACGC
CCTGCCGACGGCGGGCGATTGCTAACCGGGGGTGGGCCTTCCGCGCTCTCTGCAGGCCGCAATACGGACCAGCGGATCTCCATCGCCGATCCTACGAGCT
GGCGCCGCCTTCACCCACCACAGCGTCGTCACCGAGGCTCGGCCCGAGCGAGACGACCCCGGGTCTCGAAAACCACGTGTATCCGCCAGAGGCAGGCGTG
CTGCGATACACAAAGAGCCGGGGCGCCGTCACCTCATCGAACAGGAGCGAGCTCCGCGAGCGTTGGTGCCGCACTCACAGCACGCTGATGACCCGGCAGC
AGGCCAGCGGGCTGCAGCAAGGTGCTACGGCGCCGTAGGGCAGTGCCCGCATGGCGTGAAGCTCACGGACAGCACGCGGCAGGCGCTCAACAGCAGGATG
TCGGCCGGGCCATGCGGTCGCGCCGCACTAATGAAATGCCGGCCCGGCCCGTGCACGCCGTTAATCCGTCGGCCGCGGTTTCGTTCGGCCAAGTGCCTCG
AGTCGAGGTCGAGGCTCGGCCTCTGGCTCTTCTCTCCGTGAGTGACGGCGCGCTTGCACCTTTGGCCCTGCCACGCCGAACTCGCGCGTTTGAAATGTTG
AAATGGCCACGCTGCTCGACGAAAGGCGCCGCAGCGCGAGCTGTCCGCACCGGCCGACCGTCGGCCAAGCCAGGACGCTGCTGGCAATGACAGGCATGCA
GGCAGCATTGACGAAAGCGTTTTTCGCGCCGAGAAGGGCCATGCAGGCACCGAAATGGCCCCGTAGAGGCTCGAGTTTGGCTTGGCCAAACTGCAATCAC
CGCGATAGGCATGCGGCGCTGCTTCAACAGCGGCGGCGGCGGCGGCGGCGGTGGCGCGTCCAAACGCTGGTGCAGGACGGAGTCCGTCCGACGGACGGCC
AGCCCATCGTGCAGGAGCGTTGCTGCTGTTCTCGAGGAGCGACTCGGGGCAAAGCATACAGTGGCGCCGTTAAATCGGCGCTGATCCTTTGCGTTTGAAT
CCGGCCAATGGGCGGGCTTCGCGCGCATTTTGGGGCGCGCGCATTGGTTGATCCCGCGCCTGCTCTCTCGTCACGCATCCGACCAGAAACCGGGCTGCGC
AGGGATGGGCTTGGGACACGCGAAGGGATCGGAAACCGTCTGCTCGCGCCGGGGTTGTACCTTTGCGACCGCGTCGCGCGCCGCCGATTGGAGGGCCGGC
GCCCAGATGGGGGGGCTGGGCTGGTTGATTGATTTCTCCGGGCTGCCTGCATTTAGCCCGGCTAACTTTGGGCGGGGTACAGCGACGGCAGCAGCGCTGG
AGCTGGGGCTGGAATCTCTCGGGTCGACCCCCGCGCTGCATAACTGCCATATCAGTTGACACGCGTCTCAAGAGAACGGGCAGCGGGCCCCGTCCCGTCG
TGAGCGCCCTTCTCGGCGCCCAACAGGCGGAGACTTTTTTGAGTGGGGCACTCACAACCGGACGCATTCAAATTCCGGTCGCAGCTGCTCCCCTACCCGC
GCGGCTGTCCCTTTTTTCCCGCTCCTGTGCAAGAACGCGAGGGGGGGGCCCTTCAAACCGGGCCAAGCCGAGTGAGTGGTCGTCCTGCGCTTACCATTGT
GTTTCCTACCAGGCCGTTGGTACTCGCCCGTGGTGCCTGTCTCCGCCAAGGCCCCAAGTATTTTTTCTGCCGGAGTCGGGGCAGTTAGTTTTATGGCCTC
CACGTCCGCGTCCTCGGCGTCCCAGTCCAGCAGCACCGCCGCCGCCGCCATGCAGCCGCAAGATCCCGCCGCCGCCGCCGCTCTCGAGGCCTCCTCGGCC
GCTGCGCAGGCCTTCAGCTACGACCCGGCCTCCTACCAGCAGTACGCGCAGGAGCGCGCGCTGCACGACCAGGCCGTGCACAGCTCCATGGCCGCCGTCA
GCGGCTCCGCGCCGGCCACGCAGCCCAAGGCCGAGCCCGTCCCGGCCCCGAACTCGCGCTCCAAGATGGAGGCCACGTCCGCCAGCACGTCCCCCACCAG
CGTCACGAAGGTCCAGACCGCCTCCCCCGCCACAGCCGCTAACGGCGCTGCCGCCAAGCCCGCGGCCGCGGCTGCTCCGGCCCGTAACGAGTCGCTCAAG
TCCAACCGCCTCTGCACCATGCCCGGCTGCACCAAGCGCGTGCGCTCCAAGGGTCTCTGCAAGGCTCACGGTGGCGGCCGTCGCTGCATGGTCGACGGCT
GCGAGCGCAGCAGTCAGGGCCAGGGCCTCTGCATCCGCCACGGCGGAGGCAAGCGCTGCACGCAGCCCGGCTGCACCAAGGCGTCCCAGTCCAACGGCCT
GTGCAAGGCCCACGGCGGTGGCCTGCGTTGCCAGAGCCCCGGATGCACCAAGAGTAGCCAGGGAGGAGGTTTCTGCCGCGCCCACGGCGGTGGCCAGCGA
TGCGAGAAGGAAGGATGCAACAAGGGCGCCCAGCGCGGGGGATTCTGCGCTGGCCACGGTGGCAGCCGCTTCTGCCAGCACCCGGACTGCACCAAGAACG
ACCGCGGCGGAGGCTTCTGCGCCGAGCACGGAGGCGGCAAGCGCTGCGACCACGCCGGCTGCAACAAGCCCGCGCGCAAGAAGGGCAAGTGCTCCTACCA
CGCCAACGCCGCCAAGGGCAAGCTCCCCAAGGACCAGCTCGCGACGGCCGGCATGCCCGGTGCTTCTCTTCCTCAGCACATGATGGATATGCGACAGATT
ACTACGCCGACGTTCGCAATGGGTGTCAAGGATTTGCGTGACCCACACATCGCCGGCCAAGTGGACTCTCGCGCCGCGTACGTGCAGCAGCGAGTGGAGA
TGGACATGCGCTACAAGGGCTACGAGGCGCCGAACGCCGGCCAGTACCTGCAGATTCACGCCGACCAGCGGTCGTACGAGCCCATCAGCCTGCAGCAGGC
TGGCGGCGCCGCGCGTCACTACATGCCGGTGGACAACAACGCTCTGCCGCCCGTATCCGGCAGCATGTACAAGCCCGCTGGTACCATGGAGCGTCAGGCT
TACGCGCCCCGCACCGCCGAGCAGATGAAGAACCCGTACACGCAGCACTGGGCCGCCAAGCCGGAGCTGCCCCAGCACCACCCGGACGGAAGGGTTGACT
ATTTCGAAGTGAACAAGGAGCAGCAGCAGCAACAGCAGCAACAGCCGAACCACCACCTGCCGTACCCGGCCCAGTCGACGCAGTACCACCACCACCTTAG
CGCCGCAGACTCCGCCGCCGCCGCCGCTGCGGCCTACGGTCAGCAGCAGCAGCAGGCTCCGCGTGGATACTACACTCAGCAGTCCGCCCAGGCCCCCGCA
TCCAGTGAACAGTCTGCGTCCCAGCAGCAGCAACAGCAGCAGCAGCCCAACATGATGTATTACTCGGCCAACGGGTACCCGCAGCACCAGATGCACAACC
TGCAGCAGCAGCAGATGCAGATGTTATAAGTCCAGCGACGCCGCTGTGCAGTCGCTGGACGCGTCTGCTTCTCGAGAGTCGCGCGATATGAGACGAAGGT
GACGACGGACCAAGTGCGAAGCGACCGGATTCTGACTGCACTGCGCTGCAAGGCAGTAATAGAGATAGAAACAACCCGCTATGGATCGGAGCTCCTCGCA
GTCGAGGAAGCGGCAGAGAAGTGTTTTCGTGCCGTCGGATTTGGGAACGTAGCTTCCCTCCCAACCAGTTTTGACACCAAGCTAAAGGAAGCAATGAGCA
AGAACGAGCATTATCCACTTAACCGCGTTTTGTCTTCCGACCTGAAGCGCGTCGACCTCAGGTGTCCGCGCAACTGTAGGTGCTCTTGTCCTTGTGTTCG
ATCGCGTGTACAGCGGCACGGCCACATCTTGGTGTCTTCATGGTGCAAAAGCCTGCCGGCGTCATCACCTCGCCCTTCTCTTGGGGCGGAGCAGGGGCTC
ACGAGTTCCAGAGGACGCAACGCAAAGTGCTGGCACGTCTGAAGTGGACAGCTCTAGGTCACATTGCACAAGCTAACATTTCGGCTCTAATAGTTACGGA
GTCACAAGCTACGAGCTGCTCCGACTGTACTCCGTCGGCGTGGACGCTCGTCGCGCGAGCAGCGCGGCCTCGTCCTCGTCGTCTTCGTAGCTGCTGCTGC
TGCTGAGGTCCCCCGCTTCGTGCTGCAGCCTGGCGGTGAAGCTGGTGGCTCGTCGTCGGGGCGCTACGGCCGCGGGGCGTCGTCGACTGGGGCTGTCTAT
TGCTACAGCGGCCGTGGGGCCCCGGACGTCTTCCAGCTTGGCGTTGCGGGCCGCGCCGCCCCGTCTCGACTGCAGCTTGGCCTGCAGGTAGGTCCCAATG
GCCGACGTGGGCAGGTGCAGCGGCCCGGGGGACGAGACCCGCGGCGAACCGGCCTCCTGGTTGTCGTCCAGCGCCACGCGGAAGCTGCCCTTGCCCGCGT
AGTAGTGGCGGTAGCACTCGACGAGCTCGTGCTCCATGCCCGCGTAGGTCTCCAGCAATTGCGCGGCCGACGCCTCGTTACCCGGCTCGTAGACCTGCAG
CAGCCGCGTGAGCTCCGACCGGTAGTCGCTCGAGTCCCGCTGGTTGTCGCGGCTGCTGCTCTGCGGACGCATACTGGGCTACTGGAGGAGATCTTGAAGA
AGTCGAAATGGACGCTGCTGAGCAGCCTGTAGCCGACCAATTCTATATTTTTTTCTCGAAAACGGTTTTTTCCACGGCTTTCGATTCCACTTCAACTACT
CTAGACCATGCTGCTACATGTGCCGTCAAGGTGTTCGTTCGCCCTGGGAGATCCTGGCATCTGTCTGTGCGATTTGTCATCGACTTAGATGCGTGACCCA
TGTCAATTTTAGTGCTGGCCCTGAGCTTCACGCAGCAACGTCTGGAAGCACCGGATCAGCGTGGCGATGCCCGTTCGCAGCCCCTCGTCTCGCTGAGGGG
GAGCTGGTGTCGTGGCGTGGGCGAAGTCGATGAGGCGGATGTCGGCTGCGTGCGATTCTGGTCCGGCCTCGCCGTCGTACAGGAACAGGAAGGAGCTGGC
GATGAACTCCGTCCCTTGCTGGTCGTCGAACCACGACTTCAGCTGATCAAGGCGATGCAGAAACTGAAGTAGCAGCAAGCAAAGGAGCGTTAATACTGCA
GCACCACGTCAAGTCTCGCTACAACACCCCGCAGCTAAACGTACCGCTTCCAGCAGCTTGACGGTCTTGGCCGTGTCTTCCTGCGGGAAGTAGTTTCGGA
AGGCTGGAACAAGCTCGTCCACGGAGGCGATACCGCGACCAAAGTGCTTGTCGAACTCAATGTAGCCCCTCTTCTTCGGGTCGAAGACCTTAATGCCCTG
AATACGGAAGCCAACCGTCTCCTGCAACGGGAACTTGGACTTCTCATAAGCGATCTTCTCGGCCGACGCGTCGTCTTCGTACGACCGGGTGCCCATCTTG
ACGTCCATGATGCACGGCCACTGCCTCCCCCACGTCAAGTCTTCCAGGGCCAAATAATCTGCATACAGCAGCAAACTCAGCGCATAAGCTTACGCAGTAA
ATCGCGCGGCCCTCAACTCCAGCCACGTACGTCCAGGGTGCAGTCCATTGACCTCTTGGGCGTCCTCCACTTCACGGACCACCACCGTCCCATGATACTC
TGGTAGAAATTGCCTCAGCGCTGCGAACTCTGGCGGGTCCTTCTCTGATACGAACACGCGCTCGTAGAAGTCGCGCTCGCGCTCCCCTCGCTGTTTGCTC
TGGAAAGGCTTCAAGATGCGGCCGTTGTGCGACTTGAGACCTGGCAAATGCAGCGACGGCGCGGCAAAATTTACAGGCATTTAGCGTTGTAGAATAGATC
CTCATCAAGCACAAATGCTGCGCGGCTTCTTACTCGTCTTGGACGTAGCGTGCCCGCCCACTTGGTGCGCCATCTCCACGAAGCCCCGCACATCCATGGT
GCTACAGAAGCTCCTTTTGCGTCTACAGTTTGTACTATTTTGTGAAATAGTCCGCCGGATTGGCCTCTGACTCAGATTTGTGCTCCCTCAAACGCGAAGT
CAGTTGCAAATTGACAAGCATGGCTCGAATTCTGGTGCTGGGTGGGACCAGCTACGTGGCGCAGTTCCTGCTACAGCGCGTACTGCAGGACGATGCGCTT
CGAGTTGCGAGTGGAGACCAATTGGGGGAAATATCAGCAGTGGCGTGCACTATTCGCAGTGAACCGTTCTCGCCACTCCCTGCTGGGTTTGTGACGGCGG
GGTCGGAACCCGCAGCTCGAGCGGTGCGAGTGTACTGGCAGGTGGATATTGTGGACGAGGAAGCTCTGGAGAAGTGCGTCCAGGACTTCCATCCGACGGT
GGTCATTAATTGCGCAGGTATGTTAACCCTTGATGTTGGGTAGGAATGCTGCAAGTATCTAATTTATCTATTGTGCAGCAATTTCATCGCCTGCAGTATG
CCAGAAGGACCCGAACAAGGCGTGCGCTGTCAACGAGGTATTCAAAGCAGAACTACCTTGAATAATGAGGTGTATATCTTACTTTGTCCTGACTGTTTTT
GTATGAAGCCTCGAGGTGTGGTAAATTTGCTGGAGAAGCTTCCGTGGCGAACCCGCTTCGTGCACTTTTCAACGGACTTCGTCTACGAAGGAACTCAAGC
GTGGGGTGAAAGCTACGAGGAAGACGCTGCTGTGTCCTCATCGAAGCTGTCGGTGTATGGGGCCAGCAAATTGCGCTTCGATCAATTTCTCTTAAGTGGT
CATTGGTCGGCGAATTTCGAGTTTCTGGTGCTTCGCATCGCGAACGTTGTTGGACCAGTAGCTCCTGTGTTCCCGAACAAGAGTGCACCTAAGTTCATGC
AGTGGCTTCATCAGCAACTCTTCCAACCCGAGACTGCTGACGTGCCTCTGAAACTCTGGAGTGACGAGTTCCGCTCGTATCTCTACATCCACGATTTGGT
CTCCATCCTATTCAAGTTGCTGGCGACCAACGCTAACGCATCCGCTACACTTGTGAATCTCGGTACGTTTCCCTGCAGAGGCATCTCTGTACATATCTAA
TGACGCGCTCTACTATTTGCAGGTGGCTTGGAGGCGCTTTCGCGCGTCGAACTCGCTCGTCGGTATATCGCTGCCGGTGCGAAGCATCATGTCAGCGCAG
TTGCTACCGTAACTCGGGCGATTGAGCCGACAGCTCGGGCACGAGTTGACCTGGGATACCCTTCACCACTCAACACAAAGCTCAGCACAGCACGCCTCGC
TCACCTACTACCAGATTTCGAGTGGACGTCAACGGATCAAATACTAGACGAGATCAGTTGTAGTATTCTTGCTTGAAAAGAAAAGCTGCAATGCTATTCG
TTCAAGACATTGTTCCTTCGTAGTTGGGTAACAGTGAGGTAAAGAAGAAAAGATTAAACGGCGTCACCAAGAACTCGTCAAACCTACAAGAAAAAAACGC
GCCCCACTCGCGCTGGTCGCAGATAGGCATCCCATTACTGGATCTCCATCACGTTGCCCATACTCTGCCGCGCTTTCTCGAAAGCTTGCTCGATGGGGTC
CTCATCACTGCTTGACGTTGGCGAATAGACGAAGGCTGCATCGCACAGGGCAATGGCATTACACGCTTCACTTGGACTCTTCCCCTCGCGAATCAGCGAC
ACCAGCTCATCGAACTTGGAAGAAAGCGCATCACAGCGCGCAAGTGGCGGCAGAACCGTGCACATTGTTTCCAAGGTCACCTTCGCCTCGTGAAGCGCCT
TCTCGTTATCCTTGGCATACTTCAAAAGCTCGGCAGTGTACTCGCAGAACAGGCAGCCCACCGACATCGACTTTTCCTCCGGCACTTCCTTCACCGCTGT
AGGCTCACATGCAGCGATACGCGTGCAGATCGTCTCTACATCTTCGTTCTTCTTCAGCGAATCGATGATCACGTCCTGGTGCTTCATCAGCAGCTCGCAC
TATTTCAAAACAAGACACCACGTAGTCAGTACACAATTAAATCTGAAGATTCGTACTTCCATCTTACCTCGCTAGAATTCGGGATCAAACGGCAGATGGA
GTTGATCTCGCGCTCAAATGTGGCCAAGCTTTCTGTACGGGTGATCAGAGACGCCAGCAGCAATGTGTTCTGCTGGCACGTTGTGCATTTCGAGGGCAGG
AAATCTGACCCCTTGAAGTCAAGCAGACCCGACATCAACGAGCTCGAATCTTCCAAAGCCGTACAGAACTTCAATGCCTGGCAAATCTCTTGGGGCTCCT
TTCCGGCTTGCAGATCAGTCACAGCTTCGTCGAACATCTTGAGGTCATCGTGACACTGCCGCAACATAAACATCATACCAGCGCCGTCAGAACTTGCAAT
CTAACTTTGAAGCAGTGCTCCGCTTACCATATCGTCGGCAGGAAGGAGTTGGCACACGATTCCAGCCGCCTCACGCATTTCCTTGACTTGTTCCGGCTTC
TGGTCAAGAGCGAACTTGAGCACAGTAACGACACCACTGCAGTACGCGCATGTGCTGCTTCCCTTTTCGGCACTTCGAACCGCAATCATATCAGAGGAAG
GACCCGCAAGCTTAGCCATAGCAGGGTTCGTGTCGGTCGTGCAATATTTCAGATCGTGACAGATTGCCTTGGGCTGTTCGCCCTTCTGCAGAGAGTCAAC
CACAGTATCGAACTGCTTCACGAATGAGTGGCACTACAATAGCAAGCATTCAGGGAACAGAACAAACGATAATCATTAGAATACGAAAGTCTGCGAAGAG
GTGGGATGAAACATACCTGGTTGTCGCTCGGGAGCATTCCACAAACCACGTCAGCAATTTGCCGGATCTCCGTAATCTTGCTGGGGTCTTCAGCCACAGC
CACCTCAATGACGGATGCCACTTGCGTGCAGAAGAAGCATCCGTCAACTGACACCTCCATCGAGTCTTTCACCATTTGCACCAAAGCCGGGTTGAAAGCG
GATAGATCGGCATCGGAGGCCGGCAATGCAGCCGCTGCAGCAGTGCAAAACTTCAGCTCCGTGCAAATCGCCTTAGCGCTCATACCCTTGGTAACTGAGT
CGATAACGAAGTCAAACTCTTTCACGTACACGTGGCACGGATTGTCCGAGTCGAGCATATCGCAGATCATGTCCGCATACGCGCGAATCTGGCGGATGTT
CGCACCGTATTGCTGGAGCGCAATTTTGGCCACAGTAGTGGCGAATTGGCAGTAGGAACACTGCGTAGCATTTCCAGGCGGCCATTGCGAAGCCACGACC
ACGCCCTTCATCTCATCAGCGATGGAAAGCGCACCCTCCTGCCAGCCTTCCGTTTTGTTGCAGACGCCAAGCGACTTGCAGATTTCATGAGGGCGCTTGC
CCTCCTTCTCCATTTCCACAATCTTGTCGAAGTTCTTGTCGACAACATCGCACTTACAGTCAGACGGAACCAGTTGGCACACGTTGGTCAGGATCTTCTT
CACGATCGGCAGCTTTTCGGGGGACGTGTGGTTAACATGGTGAATAACAATGGCCACGCGCGAGCAGAAGAAGCAACTGCCGTGGGGGTGTGGGTGGGGA
GGATGCGGAGGGTGTTCACCACCATGCATCATGTCTATTCTGCCATGACGACCGTGACGGCCGTGATGTCCCCCGGGTCCCATCATACCCACGCGGTGGT
GCATTCCAAGAGGTCCGTTTCGCATCATACCCACACGAGGGCTTTCATCCAATTGTGGGGGTGCGTCCAAACTTTCGGCAGAGCAATAGTTCAGCGCCTT
GCAAATGTCACGAGGGTGCACGCCCTTCTTCAGCGAATCAATCACAGTATCCAACTGGTTGACATACACGTGGCAGGGACTGTCATCGCCCAGCATACCA
CAGATCATGTCAGCGTAGTCGCGAATCTGGTCAATCTGCTCGGGGGCCTCTTGCATGATAACCTCCACAACAGTCGTGGCAGCATCGCAGTAGACGCACG
TTTTGTCGTCACCGAGCATTTCGGATGGGGGCATTCCATGGCGAGGCTTCATGGGGCAGAACTCCATGCTTCCACAGATCTCGTGGGGATGCTGACCCTG
CTGAGCCAGCTGAACAATGCGATCGAAGTTGGCTTCCACTTCTTGGCATTTAGCCTCCGGCGACGCCATTTGGCACACATTCCCCAGCACAGCCTTCAGC
GCCGGAAGCTGCTCCGGGAAAAGGTTGTTCACTTGGTAGATGACTCCAGCCACACGAGTGCAGAAGAAGCA