Description :
From Genome Similarity Track
Location :
Scaffold_844:7163- 10979
Transcript NameFunction/comments
Phypl_g11261hypothetical protein
Phypl_g11262hypothetical protein

Sequence
3816 bases(100 bases per row)
GAACAAGTATATCACCCCGTGGTGTTCGCAAGCAGAAGTCGAATGAGTTGAATTATAACGTGGTAGAGAAGGAAGTATAATTAACTACAGCATGCTGGTG
GGGCGTCAGATCCGGATCTTGACTAGGCATTCCACGTTGGCATAGCTCTTCAGACCGCCGAAGCTTCAGGGACGACTTGGACAGTGGGCTGCTCTCCTAT
CACGTGGACACTCGAGATCGTGAAGTGCGTGAACGGGGAAGACGAGATCCTAGGGGCGATCACAGCGAGTATCACGCCCCGAtccaaggtggacgaggcg
ctgacTACGATCGCACCCAAAAAGGAGCCACGACGTAAGACCCAAGCACCGATCCCGACCGTGAGGACGGGCGAGGACCTGTTCGTGGTGAGTTTTGATG
GATCTGCCCGTGATAagcgtggcggcggtgccTACAGCGCGATCTTGTGGTAGTTGCCCGAGTGGACTGTCTTGAAGGCCCGATCGAGCTATGCTGAAGG
ACTGACTGTGAATGAAGTGGAGTACAACGGTCTCCTGCTATGTTTTGACCTGTTGGATACGATGGACCAAGGCCGCCTGGTAATCTGTGGCGGTCGAATT
CGTCTGGAGCAGTAGATCCAGACTCATCCTTGATTGGTGCATCCTTTCGCAATATCGCCCGCGGTATGGGATACACTGGACGCTCCACTGCTGGTCCTGG
ATCAGGTAGGTCTGCCTCCGGGGGAACGGCCTCTGCCGTCGCTTGGAAAGCCCGATTCTGCCATTCATTATAGCGACGCGACCCGATCTCCAGCTAGCCA
CATCGCTATCCGTACATCCTGTTGGAGGATGAGGCGGCGGGCACTGATATTAGTGATCCGCAGGTATCGGCGTCTTCCAGGTCCTCCCGTCACAGTCGGC
ACCCAGCGATCACCGCGTGTAATCCATAATTTCTCTCGATCGGATAACGCACGTAAACGTATAAAAAGTCCACACAACTCCCCGATCTCGATCTGGAGAT
GTTCACCTATCGTCACCAGCTGGACTCGATCATTGCAAAGCTGCCGTCGACCACTGAGTTGGATCTTGATCTCATTTGGTAGGCAGATTGACCCATCTGC
CAGATCAAGTGTGATCCCAGCGGGGACTATGAAGTCCATCCCCAAAATCGAGTCTTGACCCGACAGATCATCCACTCAAATATCGAAAAAGCAGACCAGC
GACCCTGTCAGGGTGATCTTGACCCGCGTCTTTCCTTCCGTGACGTACACGTTTTCGCCGATCCCGACACACTCCTGACTCTGACTCCTATCGACATGGT
ACCCAACCTTACGACCAAAGGCGGTGTCCACGATGGGCACCTGGGCACTAGTATCTAAGAGTAAGATCGCCTTGTCATTGTTGATCTTGCCTATCGGCTT
CGTCTGTCGAAACCTCTTCCCGGGGGCATGATACTTCCAGTAACCTCGGGACTGTCCTGGTAGGATATCTAAAGACATCATGACGTCCGATCGGCAATAT
TCATCGACCTGGCGAAGATTTGAGATCACAGCAGTTCGTTCTCATGCAGATCACATGTATTATCGCGTAGATCTTGTTGCTGATCGCTGACTTGATCTAT
CGACTTCATGTACACAAATGCATAAATGCAAAACCTAGAACGCTCGGCTCGTATTGGGTTCCAACCCGACGAGCGTCCTAGTTAACATCTTCTCAACCCT
TGCAGGCAACACGCCCGCATGCTTGGGAGGATTATATCACTGACGGATCTGGTTGTAGCATTCTTCCATCGGGCACTTCCCTATGTCGTGATGCTCTCCA
CACCCGCGACACACGAACAGACAGTGATCAGCAGGGTGGTCTCGCTTACCAAACTTTTGGCAAGTCAAACGTTTCCAACTGCCCAGATCCGTATGCTTAC
GAGAACcacagcgcgagcagcgactgcgatcCGATCCGTCGGGAGGTAGCAGCGATCTGCGACCATTGGGCATCTGATCTGCCGCGATCCGACCCGGTGG
TAACCGATCCGCCTGGGCTGGCTCGCCCCCTGCCGGAGGTGGAGTAGCATCTGTCGATGCAAGGTAGATCCGACGTAGATTGCCCTCTGAATGAGATCCT
CCGGATCCGTCCAAGCTGGAGTCCGATCCCGACGGAGGATGTAAAGACTGGATCGCGCGTACCGCTCTCTTGGCTGGGGCGGCTGACGCAGGTGCAGGGT
AATTCTGCCGATACTTGGATCCGAAGGCCGATCGCTTCTGTCTACTCTTCGCccgttctcgagctcggAGGACTTCATCCaacgcgtcggcgtccgaaAG
GCGTAATAGCGTCAATTGGTTCGCCAGATCCTGATCTCGGAGCGTTTCGATGTAATGATCGACGTGCTCGCGGCGGTCCTTTCGGTCGCCGTCCTTGATC
TTCAATCGTGCACGTAGACTTGCCACGTTCAAATGGTAGAGATAATCCAGCGGTGATTCATCCGATCGCTTGCGAGCATGATAGTACTGCCATGCGACCG
AGACTCCAAGTCCGCAGTACTATACTTGGAAGCTGTGAAGCAGATCGCTCCACTTGTTCCGCGTCGATCGACTCAACTGGCGGTACCAATTGTTGGCAGG
TCCGGTCAGCAAGTCTGAAAAGGTCAGGCACATCTCATCATCCGAGGCTTGATCTCGTAGGAATGCCGACTTGACCTTACTGATCCATGATCTAGCACGG
TCCTCGCCTTGATATGTGTCGGCAAACTCTTTCAGATCTGAGAGCGCTTAGATTCGGACACACTGGATCAGTGAAGATCCGCCCGCTCTGCCTGAtacgg
tggtggcggtcgtCACCACTGCACGGTCAGAGCTCGGCATATCGAGATCGTCCGGGTCGTACTCTCCATGAGATGGACGATGGTGTCGCGATACCACCGA
CTCCATGTCCacatcttgagctccagcataCTTCGGTCGATCTGCCGCTCTCGGCATGATCGTTACCTGCTGTTCCTTCAGGAATCGGGTCATGGGGGCT
TGAGAGTATGGCTCGAGCTTATCCTGCGGCGTCACCGCATCCGTGATCGGGATAGCTGGGTTCGGTGACTTCTTCTGTCGATCCGCCATGGACGGTACAC
GATCGGGGAACTTCAGCCGGGATCGCAGTAGCGCTGCACCGGAAGGTCCTAATGATATCCGTCGTGGGACGCTCGAGCAGTCCGAGCCTGGCTCTGAAGT
GGCCGATTCGTAGTGCGATGATCCCGTCTGGACTTCGGTGGTGGACAGCTGTCGATCTCGCATCACAGGGGTTTCACCCACTAGGAGCTGCAGTGTCTCG
ACCAGCTTATGCGTTGCGGATCGGATTACCTCCAGATCTATATCGAACAGGTCGTTGGTATCGAACGCTCCTGCCACCAGAACAGCATCCTTGAGTAGAT
CCAGCAAGACCTTCACCGCATCCAGCTTGTTCGACGTCGCCGGAGGGATCGCTACCGGACCCGTCCGATCGCCAATCAGACGTACCTGCATGATCTGCAT
CACCGGACCATGAACCAGGAAATCGCGTAGGGTCTTGTGATGATAAACGATTTCGATCGTGTCTACCGACCACGTCGCTGAGAGTGTCACAGTCGGATCC
CCCGCATCTGACTCTagcgccttcagcttcatctttGCAaccttgctcttcttcttcttctgcaacgACCTTATAAAAATAGGAGTCGTGAACACTTAAG
ATTCAGGCGTGACCTTCTTCTCTTCACTGGGAGTAGTGAACGAGAAAGGTTCAGGTGTGATTTTATTGTGCTCACTCGGCAGATCTCGATTCTCATCGAG
ATCTGCGGCGGTCCCC