Description :
From Genome Similarity Track
Location :
Scaffold_76:71604- 73546
Sequence
1942 bases(100 bases per row)
ATGGCGTAACCTTTAGATGAACTCCGTTTGGACTGTGCAAATATACAACTTTTTGTACACACAATCACATCGATTCGAACCCATGCGCTTCATTACTAAG
CTGCTTGTATTACCAACTATGTGTAAAAAATTATTACGAAAACCTTTATTCGCGATTCGAAGAACTGAGTCGGCACTTGACTTGACTCAACAACTGATAG
GTAAGGTCGTATACCAAACGAAAAAATACGGCGATATACCCATGACGTTATTACGTACCAGGATACAAAAGAGCCAAAATCGACTTTTTTAAGTAGCTGC
TTAACGAGTCGGCATCCAATATTATGCTTGAAAATACGGTTTCGATATAAATGTGCATATTGGTCGTTAATGCCACGGCTTGGCTATCAGGCGAAAGCTG
CTAATAGGTGCCTTGTCACTGGTACTATTGAAATTTGTCGTTATGTGTGCATACTTCCATTTAACAGCACACAAATGACCAGACTGGGCTTATCGTCACA
ATTGACTCAAAATTGTGTTTGCCATGCGTATTGCATACGCCTTGGTCGTATTATATTATATATTATTTCGTCATCATACGACATAAATATATATTTATTT
TCCAATCTTGCGGAATATTCTAGTTGTTTTCTGCATTATTTGATATATTTTCTTTTTACCCTATGTAAAGGTAACTGCTAAACAGCTGGGTTCAGTTTTT
ATAGCTGTGTTCAGTTTTATTTAGCTGGGTCATTTCTAGGTATAGGGTAAAATAACTGCAACTCAGGACTCATGCTGTTGCGTCGTCAAAAGAGCGTTTT
TTTCAAAATTGACTTTCTTGGTTACTCCTTCACCAAAAGGGTCCCTCGCGATAGCTCCGCGTTTCATATGTTATGTACGATTAACTCTTGTTGACTCAGT
TTTGGTATTTTAGTCCGTGCGCCAACTCCAGGTGCTATCGGAAGCTCTCCGCGATATCGCAAACACCAAAGTTTACATATTCCCGACGCAAATGCAATCA
CGAACCTCCTTCTATTGTTACATTGTGAGCTTTTGATTTTTGCGAGCCCAAAGGGCGAAGCTATTAGTGACTGTGCGCAAGGTGAATGCCGAACCTTTCA
AATCGTATTACCTGTGTGTCTGTGTAAATAACTAGGTATCACTCTTTGATTAGGTCACTAAGTGCGACTGCGAAGTGTGTAATGTCCACGCACGCACCAA
TGCCGCACGTGACTGGATTACAAGTGACGAAGGGTGGACAGGAGAGATTCAAGCAAATAGTAGACACCAGGGGCAGCGAAAGTCTTGCACCTTTCGCAAA
CAGTAAGCGTGAAGTGGTTTTGATCTGAATTACTTAAAACAGTAAGAGATTATGGTCACGTTTTTATCTCGGTAGCAGCGGAACCTCCTTCCATTTTATT
TCTCTTTAATATGAATAAGTTTATGTCGTGGACCGCATGTCGTTATTTACGGTGTTACCGATCAGGATCTTCCCATTCCGTTTTTTTCATATTCATCTGT
TTAGAATATCGACAACATCAACGAACAGATTGAATACACACTATCCTCCATCACCCTTATTGATGAAACACACAAACTCAGTTAATTTTCTAGCCGCTGA
CCACTAGAAATCGCACGTGAATATACAGAACTTGATTCAGTTCCTTGGACTGAATTACTTATAGTAAAGGGCGAGCTCCAGAACTTGCTTTTCTATCGTA
AACTGAAAACAGCAAGAATCGATGGCCCCATTCCTGTCTCGGTAGTAGAGGAGTTCCTTCGATTCAATTTTTGATTTCATCAATCAATTATATGTCATCG
GCCACACCCTGTTATAGACAGCGCCACCGTCTGTCTCCCTTTTCTTATAGTTATTTCTTTACAAAACCAACCATCAGCAACGAGTAGCATTTACACACAA
AAGGTCATCGGTAATTTTATTAGCGCCACGACTAGGGGCACA