Description :
From Genome Similarity Track
Location :
scaffold_541:7160- 11496
Transcript NameFunction/comments
g9100.t1hypothetical protein

Sequence
4336 bases(100 bases per row)
TACGAATACGCCCGACTTCCACCTCCTGTGCCAGGCGGGCATTGGTAATCCTGCGGCAGCATGTAATTCTGGAGTGCGCTGAAGCAGTATTGTGCTTTGC
CGATGTTCTTTCGTGCGTTTTCACGACGAACACCATACGTTCGAAGGAGGTTTGTGAAGGCCTCCATGTCATCAGCCGACAGCCCATGGGAGTACACAAG
CAGGTTCGCTTCTTCGAGAGTGATCGACATGGACGTACGGTCTTTGGCCGATTTGCACATCGTCACACGGCCGCCACCAACGGAGCGGGCGATGGAGGAT
GACAACCTGAGAATGGCCATGCGCTTGGATCGACCAGAAAGCTGGATGCTGCCTTTGAGAGCAATCAATGACGTCTGAATGCGATCAAGGTCCTCGGCAT
CATAAATTGGATCCGATGCCTGATCTCTGTGCTGCTTCTTGGAACCCCATTCTGCGAATTTGTTAACGTACGCCTCCAACTCGACCACATTCTCGGCATT
GATCTCCTTCTGCAGCGAGGCTTTGCCGACTGTGTTCGCAACCGTCTGCATTTCATTCATTCCTTGCGAGAAAATCACGGGTACGACTCGGATTAGCCGC
TGAAACAAGAACTTCGCACGCATCTTCTGTTCTGGTGTCGATAACGACAAATAAATGGCTCCTGAGACTGCGTCCTGCCCCGGAACTCGGTGCATACTAC
GATCGGGGAAGTCACTTGCACGGCGTGTAATTATTGGAAGCTCGATTATGATGCCCGAAGGTCCAGAAGTGATAGAGACACGGAAAGCAGCAGCGCGCGG
CGACTTCACAGGACGCAGCTTGATGTGGACTCGCCCGAGCTCCTTGACGGCCTCTACCGTGTCACCTAACATTCCTAATTCGTTCCCGTAAGTTGATAGT
AAACTTTCCACCGAAAATAAGAAGCCAACCCGTGTAAGCATTTCGAGATAATCGACACCGCAAGCTTTCAGAGGGTGAGGACCAAAGTCACGGTGGTCGT
GTGTATGCACGTAAAGCGTTTGCTGGAAACACGTAACAAGTGCACTCATCGCCTGGCAAAAAGCCACTTCAAGCCGCCGCTCCACGTCCCATTTGAGCTC
GTTGTACTTGCGTTCTAGCGCGTTCATTGTAAGATCCGAGCCTGCTTGTGCTTCATTCAATAAGCGCGCGTGAAGTTTTTCCAGTTCGTCGCGCTTTTGC
CGAACACCCCCCGTCTTGAAACCATAAACGTGGGCGGCAAAAGCTCCGACCGTTGTAGTACCGTACATCCGGTGCTTGTAAAAGGGAGGCCGGCCTTTTG
CATTTGTATCAATCCTCATCGAAGCCTTTTTCTTCATTTCCACCCCGGGCACCGATCCTTGTGACGACGATAGGCTCCCACTGTTCGGCTTCGCTTCATC
ACTATCTAACCCGCTTAAGATGACATCGGCAACAATGTCGATCGCATCGGAAGAATCAACGTTATCATCCAGTCCGTAGATGCTCTGAAACTCTTCTTCA
GTGATTCCCATTGCAACAATGGTTTCTGCCAGCTTTCGCTGCTCCGAAGGAACGAAAACATCCTGACCAGCAGCTCCCTTGTTGACAATCGTTTCTGCGG
AATCAAATGAAATCACGCGCCGACGTAGCGCCTCAACAGGTTCCAGAGGCGATTCTTCGGACGGTGAAGGTAATTCTTCTTTCTCATCCTTGATATCATC
GTCTAAAAACTGCACAAGATCAAGATCAGTCTGCTGTTCACGCACACTAGACTTTCTCGACAAATGCAGGGGTGAGGCCATGACGCTCCCCACAAATGAG
TTCACGAGACGGGCATAACGCACTGCACTGGTTTGGTCGCCAATCTGAACATCCTTTTCTGATGTAGGATATGCATTGCCCACTGTCATCAGCTGCTGGT
GAAGATTTAGCGCCAGGAAACGCAGATCGGCGTCTGCTTTCATGGTGCTTGGTTTGAAAGTAAGTCCTGCGTGCTGAGTAGCTCCGTACCTCAAAATTGA
GTCCTCCACCTCCGAGATATATTGCTCCATCGTCTTGACAAGCTCTAACCGCCACTTCCGCTTTTTCCGCTCAACAACATCATCCTGTATCTGAATGATC
ATTTCAGAAAGCATCCCAATGCTGGTTGCTGGTCTAGCCCGGTTCTCAAGTGTAAGCGAAGAACTCATGCCGGAAGTGGTCGATTTGAATGATTCCGAGG
CATCAGACTGGAGTGGATGGGCTGTGTCATGTTCCCGCACCGTGCCAAGGGATCTCGGAGAAGCTGGGATCACCGAGGGGAAGGAATAGCCACCAACACT
TGGAGTTGACAGTTGACTAGAAGGAGTCGATGAGGAACTCTCGTCGCCATCCTCGAGCGCGATCTCACGCTTTAGCGAGTCCAATTTCACCAGTAAGTCA
GATAATATCAACTGTAAAAGTTGATAAGGCACCTCCCACGTGTACACACTTTCGATCAGCTCTTCTTCGACTAGCATTTTACCTTGTGTCCGTTGGGAGG
TAGACGCGAGGTTAATCATCTGCTGGGCGATCTCGGAATACGCGGAATCATCGTGGACTATATCATCCTCCGCATCGGCACTTTTACATCCAATATACAT
GAACGACCGAGTGATGCGTTCGAGCCCATCAGTAGACATTCCGGTATGCAAGCCCTTTACCTCGGCTTCACATCGGATAACGATTTCACCCGACGATCGT
GTCCGAGACAACGGGGAATATAGCGAAAAAATAGCTGCCCGTCCGACTGCGAGCGTTGACCCCGCCATAAATGATGTCAGCGGAACAAGAGGGTCGCCAA
CGAGCCACTGACTATCCAAGTCCTCCAGCGAGTTCAGGTTTCGAACCGAGTACACTGAAGCGCGGAGCAAGTCCTGTTCGCGCATCTCAACAGCTAGCAT
CATGTGGAAACATGGGTCTTCTGAGTAGGATATTTCAGTTCGGCCGATCTCCGCCAGCACCCCACCTGTCTCGGTATTCATCAAATGCAGCACCACGAAC
GATGATGACCTCACTGATGACATGGAGGGCAGCGTCAAATTGAAGCACTGAAATGATAGCCATGCACAGGGGATCGGCGAAACAGACTGCGCTGGCCACC
TCGACTCGTTGTCCAATGATCCATCCATCCCGGCTACCTGCCTTGCCTGCATTTCGTATTCAAACGAACCCACTGATGAGCCAACACTGTACGCGGAATC
AAGCCCAGAAGCCCTGTCCTGCGGTTGCTGCTCTTTGTTGCCACCGCCCAAATGCTGTCGTACGACATGTTCCAGTCGACGTTTAGCCCGATCCAGCACG
CTGTTCCCGAGGCCTAACGACAGCGGACTCGGCCGACGACCAAGCGTTAAATATCCACCCTGTAAGCCCGGAGGTGAATTCGGTGGCGCCTCCGCGTGAT
TAATTGCAGCGACCAGTAGCGGCCTAGTCCTCACTTCCTGCTCCAGTAACGGGGTGGTCTCAGATGTCACTCTTCCATTGTTATAACTGAGACTTCTTCT
AGACGGGATCTCGAGCGTGGGCTCCACCTCCCACATCAGCACAAGGAACAGCACGCAGGGCACAATCTCTGGAATGGCATAACCCACCACGACACACACG
TCTGGACTGTGAATATCTCCACAGCCTTGGTGCGAGAACGGTCTCTGGATGTAAATAGTTGTCCTCAATAGAAACAACAAGGAGCAGGCTCCCATCACCA
AAATGGTGAACCTTAGAGCTCTGGTCAGCTTCTTCTCCACTCTCTCGTCAAGTCTGCGCCGTAGTCCGTCCCCCGATGGCTTCAGAACTCTCTCCACTCG
ATGGCGCATCTGCCACGTGGAGTACAATAGCCCCAACGAGCTTACCAAGCTCCCTGTAGCGACAAACAGCACCGGCAGCACGCCTGTCCACAACGTCGAC
CTGTCGATCTTGGCTTGAGCATGCTTAGCCTCGGCCACTTTGGCTTCATGGAGTACTGACAGGCCTAAAACAGTGGCGTAAAAGACGCCATTGGACACTA
TAAAGGCCACCCAAAGTCTTCTGGAGCGTCGGGAGACCTTGGGGTTGGCGATATCCAGCCAGAACAGCGTCTGGAACAGCACGAGGCTGAAGAAGAGACA
CAAGGAGGTTCTATTCAGCAGGTTGCGCGCCACATCTCGGCCCAGGAACGACGCGGCACGGCAGAAGGCGAACAGAACCATAAGCTGCTGGAACGTGCTG
CGCTGCGACCGCTGCGACCGCGAAGACAGCGCGCGACAGGCCGCCACGAGCGCCAGCGTCAGGTACAGCGCCACACACAGAAGCTCCAGCGCGGGGGACG
CCTGCGGCAGGAACACGAGACCGTCGTCCGGCGCCG