Description :
From Genome Similarity Track
Location :
Scaffold_871:7160- 9622
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_871-snap-gene-0.9Ribonuclease H2, subunit B
Pytul_var.sporangiiferummaker-pug3_contig_871-snap-gene-0.8DNA ligase

Sequence
2462 bases(100 bases per row)
GCGATCAAAGCGCTGAAACGATTCGTGCGGATTTGCCGCAGATGCAGCTGACTGTGGAACCGCTGGCACCTCTTTCTCGAGGCTACGCAGCGACAAATGA
AACATGGACTTAGTGGACATTTTTAACATAACAAAAAGATCAAAAGTCAAGTGCAACACGGACTTGAACTGCTGGTAGAGCAGATCCGTCAAGTCCTCTG
GCAGGTAGTCGGCAATGAGCTCAATCGCGTCACGGTGGAACTTGGTCGCATCGATCGTCGGCGCCTCCGAGACTACTGGCTCTGCTGTGGCGGCAGATGC
GCCTGGGAGCACAAAGTTGGTGTCAAAGCCACTGTTGCTTTGCTTGGCGTTCTCAGCCACCTGCTTGGCCAGCGTCGTGGCAACGCGAGTCACTTTGGCG
CGGAGCCACTGGAGGATCTTGGCGACATTGGCCTTGACGAAGAGGTTGTCAAGCGTGTCATCATCGCCCGTGCACTGGATCTCGCAGATCGTCTCGATCT
TCGCTTGATTACACGCAGCGAGTTGCAACCACCACGTATTTTGGCCGTGCAAAAGCAGCTCATAGAGCGCCATGAAGCGCTCCTTCTGGCGCCACGTGCT
CATCAAAAGCACAAATAGCGGATCCAACGGAGTAAGCACCATCAGACTCCCATCTGTTGTTTCGATTAGGCCCAAACAGCGATGTCTTAGTAATTCAGAC
ATACAACGAAAGACTGTACAAAAAGATATGCAGCCATGTACCTTGCTGCACGTCGTTGCCAATAAACCAGCTCCGCGCATCCGCTGGCGCCTGGAGGCGC
TGCATCTCGAGCAGCTTCTTCGTCGCGCCGACGATCGCGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTGCTGCATTCTCCT
GGGGAAACGTGGACCACGTCACCACCGTGTACAGCGGCTTATCCGTCGCGTCGCCGTGAAATCGCTCGAGCTTGGCGTCCGCCTTGAGCGCCGGCACCAC
CACGAGCGCCTTCTTGCCCATGGTTGTTTGTGTCCACTTTGCATCAATTGCAAGCGCCATTCAACTGCTCGTACAATACTCTCATTGGCCAATAGTTGAA
ATAATAGACATATTATTGGTTGTAAATAGGGTAGTTACACTTCACAAGGAGTTATGATTGGATTAAAAATAGTAAATAAAGGAAGCGCCAAAATCCGTTC
GGAGTTTTCGCGCCAAAATCGGGCGACCAGGGAGTCAGTCGTCGACTGTAATTAGGCATTACTTCCGTGCCAACCCAAACGCCAAAGAAGTGAAAGCGCA
CTGCCAATCGCTCTCTATCTCTCTGTCTGTGCGCGTGCGTGTGGACTCCATTCTTCAGACCTTGCAACAGCACGTAAGGTACCTCACGACAGCCGCATAC
AGCTGGTATCGACGCTGCGAGTGCTCTAACCATGGCGAAAGGTGCGCTGCATGACCGCCGAGTTGCGCGATGCACTACATACAGACTCACTCGATGTTAC
CTCTTTCTTGCATGCCTCCTTCTGTGTGCGCATTTGCTATTTTGCTGTTTGTGTAGGCGCTGCAAGAGCCAAGCCGCAGCAGCGGTCGATCACGTACGTT
TTGCTGCTGTTGTCTGTGTGCTTGCGGTGATACTGGTTGACTCATCATTAGCGAGTCGCGTGCGTGCATGTGCTCGCTTTAGTTCGTTTTTCACGGCACC
TGCTCAGAAGCGTAAAGCGCCAGGGAAGGAAGAGCGTGACGAGGACTCGAAGCAAGATGCGACTGAAGAAGCAGCTGATGATGACACGACAAAGGCCGTG
AAGAAGACCAGACGCTCCGATGACGACACATCTCTAGCGCCAACGCTAAAGGCGAAATCCACTAAAGCAGCAGCAAAAACGGAAACGGTTGTGGAAGAAG
AAGGAGGCGAGCTAGAAGCGGTTGCGGAACCAGTGGCCGACGATGACGATGTGAAGATGGAGAAAGCTGCAGAGAGTTTAGACGACGATGACGTAGTGGT
GGAGAAGCACACGCCCATGAAGTCCAAACGTACGTTCTGCCCTGATTTGTGCCAATATACAGTTGTTATCGCTTGTGTGGATGGACGCTCATATATGTGC
TATTGTTGTGTGTGATGGTGTAATCAAGCTGGACGAAGACGTCTCCGTCAACGACAAGTGGAAGAAAGCGACGAAGACGACGAGGACTTTGGATTTCCTT
CAGCCAAGGCGACTAAGAAGCAGGGAGTCGTGGTCGATCTGGGGTCTTCCGAAGACGAAGAAAGCGCGAAGCCCGTGACAGAAAAGAAGAAGAAGCAAAA
AAAGGAGAACACGATTGCTGCTGCCGTAGCGCCAAAGGAAGAAGAGCCTGCTGCCTCCGTTGACGCCAAAGACGAACCTTCGACCAGCAAAGTCAAAGTC
AAGGACGAAATCAAGAACAACAACGACGCTGGGAAGCTGACTCCTACTCCCACCAAGAAAAC