Description :
From Genome Similarity Track
Location :
Scaffold_152:71597- 73107
Sequence
1510 bases(100 bases per row)
GATGCTGGCGCCCTGAGATGTATAGTTTAGTCGCTGTGACCCGCGCGAATAGAAGCGCTTCGTCATTTTGCTTTGGGACGACTGCAAACCCCAAACAAGC
CACAACCTCTAATGGAGCCTGAACTGGAGGCCTGGCGCGCACAACCTTTTGCACTCAAAATGTACGGACTCGACTGTGATTTTTAATGACTATCGGCACA
CGTGGCCGTCAACCACGCCAGAAAACCTACTGGGCGACGCATCCTGTCGATGGATCTCTTGTTGCGTTGGCTGTTAGAGCTGTGAGGCATGGCGAATAGC
AATATAACGGAGCTGCACACGCTAACAAGTCGGTAAGATTGTAAAAGTCAAGAGGATACAACTCGCTAGAAAAATACAGACAGCAAAAGCACATCCACTC
GGGATACATTGATCTCGATCGGGAACTAAACTAAACCCTCTGACAATTTCTGCTTCTTTGCTGACAGGATCGTGGCATGTGTGGGTTTTGCAAACCGGGC
TCGAACCTGGCCAAAACCAACAGAGGCGGTAATAGCACTCTGGGATCCTCGGTTTTCCCATCAAATTAGATCCTCCTTCACTTTCTGCCTCTTTGCCGTC
AGAATCGCGATTTCCTCTTCAAGATCTTGAAGAACTCTTGGATTGGTCTCACGACCTTGGAGCACGATTAAAGACCGGATCCGATCGCCGAGGAAAGTAT
AATATTTCGTTGCTGCGCTCTTCACTTCGTTTTGAAGTCTTCGCTTCATGTAATTCGATCGGTTCGATTCCTTGTTCTCCAGAAAGCGCATTGTGAGTTC
CTCCGTTTCTTGCTTGCGCATTGCAAGGGCTACCCGCCATTCCTGATTTCCAAAGTCCCGGATCGCTTCAGCTACGTCATTTTTCTTCCTGCGGTTTGCG
TCCGACCCCGTTTCACGCTGCGATGTCTCGGTGCTCTCGTAGAAAACGTCTTCGGGCAAGTCACGATTCACAGCACCGACGAGCTCACGCTTGATCTGCA
GGTGCATATGAATGTAAAGTGCATCCAAACGCCCGTTGCAGTACTTGTAGAAGTCCTTGTCGTTTGTGCCAGTCCTGGTAAAGCGGATGTGAGCTTGGCG
GTAAGCTCCGTGTGACGATCCCCAAATCTGACGGAGTTGCTTAATCGAGTGCTGGACGATGCTTGCAGGGTTGATACAGGTGGGGTCCAATGCAGGGTGG
GCTGCAATCAAATTATCGAACTCCTCCTCGGGTGTGCAATCCAAAAATGCAGCAGGAACGTCCTCCCAAAACTGCTCCTCCGCAGATACGGCGGCGTCGA
GATCAGCACGCGTACGCTGGTCGTAAAGGGCGACAAACCGAGGCGCAAAACGACAGGAAAACAGAATGTTAACCAATCGGAACGGGCACTACACTTGCTT
CGACTCGGGCTCGCGGCGCTGTTGCATCTTGTTCTCGAAAATACGCCCGTAGATCTTGTCGTTCTTCATCCGTTGAGCGATCAGGGATAAAAGCACAGCT
TTAAGTTTGT