Description :
From Genome Similarity Track
Location :
contig_17:715816- 719906
Transcript NameFunction/comments
g5132.t1XP_009514254.1 hypothetical protein PHYSODRAFT_469325 [Phytophthora sojae

Sequence
4090 bases(100 bases per row)
GACGACGAGAGTGAATAACTTCTTGTGTGCTTTAAAGAGGCCGCGACAGATATTCCTGTATACAGCTAGCGTGATGTAGTGCTTGAGGCTCTCCAATCGT
TCAGACAAGTTCCTTTTCGCGGGTGCCTCGTTCAAGCTCATGCTAAACAGTCTGTTAAAATACTCCAACGAGAATTGGTACATTGGGTCAACGTCTGCTA
GGTCTGCGATGACGAAGAAGAGCATGGCACCACGTACAGCAACGTTGTGGTATTGATTGCGGATCTCCAATACCTCCAACTTAGTAGCTTCTGACTCCGA
GAGGCGCTGTGCCACCATCGTAGATGTGTGTTTCGATGTTTTCAACGTTACAATGAGCTCAACATCATCGAGGATATTCCCTTTCGCATCTGAAAGTAGG
TTCAGAATCCTAATTTCCAAATCCTGTAGCTGCTTTTGATCCCGCGCAATACTAGCCAGAAGAGTATGTTTTCGTTCTTCGACCTCCACGCGCTCTCGCT
GCACGACGGCGCTTAACAATTGTTCTTCCAACCCGTCACTCGTTACGGTAAAGTTGATAACATTGACTCGTATATACACATCAGGAGTGAAAAGTGGGTT
CGCCAGCTTCGTGGTGAGATACAATCGGAAGAGCTCCATATCTGTTTCCACGAGCCGATCCTCAATTTTTACATGCACCTTGTTGGCAACTCGTTTACTA
CCTGGCGAACGCTGGGATGGTTTTATTGAAAGTACAGGCTCGAGCGATGGATCCAGTGTCTCATTCATATCTTCGATCAGCAACGGTTTTCCAGAGGAGA
GACAAGCTTCAACGACCTGCATCAAGCTCTTATCGTCATTTTTCACGATCTCTAAGTGATGAAATGCTTCAAGTCGCTTTATCCATTGAGTTGCTTGTTG
TTGAGGGTCGATCATCAACGCCCACCGTCGCTTGCTTTTTAACGCAAAAATCCCGTTATCTGTGGAAAATTTGTCGCTTGGAAGTCCCATAATTTGCCAC
TCCCGAAGCTCTCGAATGTCTCCGTACGCAGCAGAAAGGGTGAATGGGGTCGACACGCCGATGGAGTCTCTACCGATATCAGTCCACCGAGACAGTAGTC
TGTCTCGAAAACTACCATCGAACGGCGCCAAGTACGATATGCACGCAGCTACAAGAAATGAGTCCCCCAAAATCGAGTTACCTTCTTGCTTGAGAAGCTT
GATACTGCTCTTCCAACGCACACGCTCATCACTAAGGCCTTCCGTTAGTTTTTGTGCGTTTTGTAGTCTCTGTTGCGTTAATTCAGATTCATCCAGTAAT
CGTTGCTTTTCTGTAAGGGTAGCGTCACAATTTTCCTTGAGCCGGCGCACCTTATCCAGCACTTTAGCAAGCTCTTGTTGTTTTGTTTCAAGCTTGGCAT
TCGCGATTTCTAGCACAGCATTCATTTCAGCCAGTCGCTGGCGCTTTGGTGCTACCTCTCGGCACACACGTGCGTAGGTATCGATGGCGTGCACCCACAT
GCATAACGACATAGCAGCACGTGACACCTTTTTGACCTCATCGACAGCAAACTCAGGGCTTTCGATGTACTTCCGAATCTTCTTCAGGATACCATTAGGA
ATGCTATCCTTATCATACTCCTTGAGCTCGGCCATAAAAGTACTCCTAGATAAAATACGTTTACTGTTATCCCAATCCACTTTCTCACCGAGCATGATAC
ACACAGCCTCCATCACAACTTGTACAGCTTGGGGAGGTTTCACAAAGCCCTTTACCTCAGTAATATCCTTTTTGTCCAGAGAATCCAAAGCTGCCACAGC
CGCGTTAAGAGCTGGCAAGGCCTGGTCTAGATCGCGTTGTGCGTCAGCTTGGCATGCAGCAACTTCTTTCTGCTGCTGCTTGACGACAGCTTCATCCGAC
CCCACTCGCTGGGCAACCTTTTCAGCTTCCACTTGATCAATCGCGACTTGAAACAAAAGCTCTTCTGCTTCTTTCGTCTTGCTGGCAAGGAATGGTTGAA
GCACAACTAGTTCGTCTTGGAGTGTACTTACAAGTGAGTTAGTCTCTTCCAGTTTGACAACGCCTGCCATCAAGCGCAGCAATTTCGTTTCCCAGTGAGA
CTTCTTTTCCCGATAAATTCGTCGGAACAGTGCAATCAAATCCAAATAGTTCTGAGACGTGATGTATACACGTCGTCGGCAATTGGCAAGAAACAATGGA
AGAATAGCGCTCACTGATAGATGCGCCTCAACGCAAAGGGCGGTAGCAGCTGACCGGATCACAGGTGCACTCGCCAGGTCAGGCGTAGTGAATTTTGTAT
TTACACTTTGCAATTGTCTTCACGGTCTTCTTGAGATAGAAAAAACTCGGCAACATATTCAAGAGCGCTCTTTGGCCATTCGTCAAAGTAATCAATTGTG
GTACAGTTGATTAGTGCTGGGAACTGGCGAACACGGGAGCGAAAAGCTTCTGTTAGAGGATTCATGCAAATGACAAAATGAAGCGCATTATGCACCATCA
TGTGAAAGTAATCCTCACAGTCCTTTCGAGTGAGATCGCCGGTTTCTAAGCTGCCATTAAGCTGGCTATTACCCTCTTGTGTCGTTTTCGATTCACCCAT
GCTGCGCTCAAGTAGCGTTCTTACATCATTGATAATCCTCTCGAGTTCTTCCGTAGTGAAGAGTTTAGGAATTTCTGCACCGTTCAGAATCGTGTTAATA
TCTTCGAGAAAAGCGTCAGATGTCAATTGTGAATCGTTTAACAAGAATACAGTCGGAATGGCGCTGACGCTGGAACCTTGACGACTGGGTCCAGCGTTTA
ACGTCCGTGTACTTCGGGCCGCTTTGCTGTGGGCATCTTTACTAGGGCTTTCTCCCAACGCTGCTAGTTTCATCATCAGTTTTAAGTCTTCTCTGAAGTC
GAGCAGACCATAATCCTTGATCAGCTCAATCTCAAAACAGTGATATCCCGTCAAAAACGCAGCAAGTCGTGCGAGACAGCGCTTGCCACAGCCACCCATT
CCAAGAAGTAGTGCGTGGCCTCGAGGCTGTATCAAGATCCGTGCGATCGCAGCTGTATGAATCATTGCATCTTCAAAAAGTACTAGCTCGAGTGGTGGAT
GAGACAATGATTTACCAAGTGGACTGATATTGTACTCAGCTATCCGTCCATTCAGAAAAGCTTTGTAGCGGTCCAAATCGCCAACTTGATCGTATTTCAT
GACCGTAGCAGTGCTGTTCGTGGGTAACTCTCCTGGGGTTGCAATGCGTCGTGGCGAAAAGAGTAAAGTGCTATGCCCAGATTTTGATGGACTGCCATTA
TCGCCACTGCTTTGTCGTCTGCGACGCTCCATCGTATGTTCTATACCAATACCAATATCGACTGACCATGAAAGACCAAACACTTTGTTTGCGACTTCCA
CCAACTGCTGAGAGAGCCACTGTCTGTCCGTGCTGTCCATGAGGCGATCGCGAAACACTCGAATCCCTTCGTGAGCCCATAAATTAACTACGGTATTTGC
CGTTAGGCTGTTCGTTCCTCCGTTCCTGGCGGGTGCTCCCGATACTGAGTACCAAGCACAATTCCTTGCATGAGTTTGGTCACATCGCGCAAGTTGAACG
TGTAATGACACTTAGATGGAGTTGGGAGTAAGCCTTGCACGACGCGTTGGAAGAGTTCACATGTAGCATCTGCAGTCAACATTAGCGTATCTTTTACGTT
TTTGGCGAATACACCGCTGCCCCCGCACGCCTTGATATGCGAAGCTAAGATTGAGTTAAAAATTGCTTTCATCGCACCTTCATCACAACTAGGCAGACAG
AATATAGCAGAAAACTGTCGTACAAACCGTGGGCAAAGCATTTGGCGACCTCCGCCTGGAAATCCACCCGCTGCAATAAGAACGGAGTCGTTGACATCCT
TCCAAAAGAACTTGTCACGGTCGTAGAAACCTCCGTATTCCAGATACTGTCTCAAGAGCTCTATCACGGGTTGTGCACCGTGTTTCTCGGTGTTCGGCAT
GTTCACGTCGTCGACGAAAATGACGACAAGCTGCTTGTTCACAGGTGCTCCAAGAAGAGTCCTGCGTTTCTTAGCGAACTTGCTCTCGAA