Description :
From Genome Similarity Track
Location :
Scaffold_199:7158- 10098
Transcript NameFunction/comments
g10385.t1POM81700.1 Integrase catalytic core protein [Phytophthora palmivora var. palmivora

Sequence
2940 bases(100 bases per row)
GTGGTGCCCTGTCCTGCTGGACTCGGGCGCGTCTCACCACCTGACGGGCCGACTGGAAGACCTCGTGGCCACCCACACGAGCCCCGCGCTCGCGATCAAG
GTTGCCGACGGTCGCACGGTTGTCTCTCAAGTCAAGGGAAGGATGATGATCCAGGCGATAGTAGACGATGGAAAAGGAGGAGTCTCCACGCGGGAGTTCG
TACTTGAAAATGTCTACTACGTGCCAAAATTTCCCAAGACTTTGCTTTCAATCTCGACCCTGGTTCGTACCGGACATGACGTGGAGTTCACGCCTCGTGG
ATGCACGGTTTTTCGAGGAAATCGTAGACGCGTGGGGTGTATTTCGCGCGTAGAAGACGGAGTGTATCCCGTGCTCACTCCGGAGAGCTTGCTGGGATCT
GCCAGCGTCGCCATGTCGTCCGCGTTCGCAGTGCTGGGACGCGATCTCGAGACCTGGCATCGACGCATGGGGCACATGAACTACAAGACGCTCAAGTGGA
TGGCCGCAAACAAGATCATTAGAGGACTGAACATCCAGCCTGGAGCAAAGCCGCCTGTGTGTGTAGTGTGCGCACTCACCAAGTCTCTACAACACGCGCC
GCCAGCGGAGCGAACGAGCAGTGACGAGTTCCAGGATGGCGTCGTGCACGCAGACCTCAGTGGACCACTGGCAAAGACGCGTGGTGGCCACCGGTACTTC
ATGGTTGTGATCTGGCGCGGCTTCCTTCAAGTGTATCTACTCAAGAAGAAGAGCGAGGTAACAGCAAAAGTCCGAGCATTCTTGAAGCTAATCGAGCGCC
AGGCCGAAGTACCAGCAACCGACATCAAGGTCATACGGACAGACGGCGGGACGGAGTTCCTCAACAAGGATTTTCGTCGGCTGGTCCAGCAAGAAGGCCT
GTGGCAAGAACACACGACGCGCTACAGTTCTTTCCAGAACGGCGTCGCTGAACGGGCCATCCGGTCAGTCACGGAGATGGCGTCCGCCATTCTCACAGAT
TCGGGATTGCTACATCAGATGTGGGGAGATGCGCTGAAGCATGCAGCGTTCCTGCGCAACAGGATCCCTCGCCGAGGGGAGACTGTGAGCCCATTCGAGA
AAATATTCAAGAGAAAACCAGACGTCAGCAAGGTGCCAATATTTGGACAAGCTTTGTCCGTTCGTGTCCCTGATGAGATTCGGATCAAGTACCAGCGGTT
CTCCAACACGCGGGGCCAGCTTGGTGTGTTCGTCGGTTGCACGGATGAAGTAAAGGGATACCAGGTCTATTTGCCAGGCCCAGGTCACCCAGTCTTTGAG
GCTCACAGCGCTAAACTGATTGATCGAATGTACCACGAGCTGGAGGAAGTCGGCGACGACGACCCCGACGACTTTGCTCCGGATAGCAGTGACGAACGTG
ACGATCAAGATCAGCAAGCAAACAATTCAGACAATGAGGCTCCGCATGAGTCGCAGTCTACGGCAAAGCGCCGCTCCCGTCGCATCGCGGCCCAAACATC
CTTCGCTGCCGTCGCTTTTGTGGTTCTGGGGGAGGTTCTCCGTGAGCCTCTAAATCTGCGTGAGGCTCGAAGATCACCTCAGTGGGCTGAGTGGCGTCAA
GCCATCGAGAAAGAAGTCAAGGCCCTGTTCGAAAATGGTACATTTGAGTGGGTGGATTTGCCTCCCGGCGCGTCAGTGCTTGACCACACGCTCCAATTTC
GCGTGAAAACTGGTGCTAATGGAGAGGTGATCCAGTTCAAAGCCAGGCTGTGTGCCCGGGGCGATTGACAGCAGTACATGCTCGACTTTCTGGACACCTA
CGCGCCTGTGGCGGCTCTGACGACTGTGCGCATCTTCTTCGTGATCGTTGCCAAGCTGCGACTTGTGGTTCGTCAAGCCGACGTGCCCGCAGCGTATGTC
AAGGCAGATCTCCTGGAGGAAATCTACATGCGCCCAGTCCCTGGATTCGGGACGCCAGAGCAGCGTGGAAAGGTGTGGAGGCTTCGAAAAGCCCTGTACG
GGCTCCGACAGGCAGGTCGCGAGTGGAACAAAGCTATCGACGCGTTTCTCAAGGAATATGGGCTGGTGCCCACGGAAGCTGATCCCGGCTTATATTTCAT
GCACATTGATGACTCACTTCTCTTGGTGTGCCTGTATGTAGACGATTTGCTAGTGGCGCATGCCAACGAGGAGCAAGTGTTGCACCTGATGGTGGCACTC
AGTCTCAAGTTCGATGTGAAGGACATGGGTACACCCAGTCAATTCCTCGGCATGTGTGTCGAGCGTCCGAGCCCGTCGATCGTGTTGCTATCACAAGCCT
CGTACGTGGACGAGGTGTTGCACCGCTTTGCGATGGACGGGGCGCGCCCGACCAAGACACCGATGGTCCCCGGCACTCGGCTGGACTTGATGGATGGTGT
GGTTCCTGAAGATGAAGCCGTCATGATGAAGAGGATGCCGTATCGGGAAGCTGTCGGAGCGCTTCTTTATCTGGCTCGAGTGACAAGGCCGGATACCAGC
TTCGCAGTTGGACAGCTTGCAAGACATAACGCGCGTCCCAGGAAGGTCGCTTGGGATGCGGCGAAGTACCTCATGAGGTACTTGGCCGGCACGAGAAATA
TGCAGTTGACATTGGAGCCGACCGGTGAGGACATTACCGTAGCCTCCGACGCTGACTGGGCGAATGACCAAGTGGACCGCAAGTCAATTTCGGGCCGCGT
TGTGTTTCTCTTCGGGTGCCCAGTTGCTTGGGCTAGCAAGAAGCAGACTATTGTGACGAAGTCGAGTACTACCGCAGAGTATGTGGCTGCAGATGACGCC
ATTGAAGATGCCGAGCTGGTGCAGTTGATCGTCGAGCAAGTCCTGCGGAAAAGGGTACCGCTTGTGCTCGCGATGGACAGCCAACCTGCCATTGCTCGTC
TCAAACGCCAAGGACTCAGCGAGAAATCGAAGACGGTGGA