Description :
From Genome Similarity Track
Location :
contig_78:71574- 73211
Transcript NameFunction/comments
g10172.t1hypothetical protein PHYSODRAFT_353072

Sequence
1637 bases(100 bases per row)
GTTACACCGAGGCGAGGCGCAGCTTTGCAGCGCTACCGTCGCCTCCAGGATCCAACGATGGACACATGAGCGATGGCTCCTGTGTTGAAGTTTAGATGGA
CAAGAAGAGGACGATAGATGGACAATGAGAAGAGGACGATGTACGGTAGCGTCCGCAAAGCCCGTTATTTATCCACATTAAAAAAAAATGGATTCGTTTG
CGAGATTCCTGCCCTGCCCTGGCAGTCCATTTCACTGCCGAAACCACAAAAGCCGCCATCGCAAACTTCCACCAGTTCCACAGGAACTCTGTCGAGCTGC
ACGAGGTAAATTGCGGAAGCGTCAGTTATTTTACTGCAGGCTGGTCAAATTCATCATTGAGCTATTTTTGGTTTGATCAGTAACCGTCGTAATCAACCTG
GGTTACATTCCGAGATAACCAGGTTACAGCTGGATCTTTGACATCTGCACGAGACATGCCTAATGAAAACAAGTCATTCCGCCTCCTTCCACAGGAAATG
CGCTGCGCTTGGTGTAGTAATGCCCCTTCGACGCGCGCTGTGTGCCATCGGCCATCGACCACCGGCCATCGATATGCAGGATTTCCTTGAGCGCGCATGA
AAGGCATGCTGTGCGCCAACGCATCCCTATTGCACGTCAACAACGCTCGGCGTCGCAGCCGCTTTGAGTCGGTTAATTAGGCCATCAACAGCCTGAATTT
CGGCCAGTGAAAACGCCGCCTTCATGTTTCAGAGCAACACCCTATCCCCCCTCGACATTCTGCAATTCCCCTTCCCAACAACGAAACTGGGCGCGTCGAG
GGCGAGGCGACGCGAGATCTCGGGACAATAGCAGCGTAGGACAGACGGACAGAATGCGCGCGCCGTCGAGACTTTTGCTGCCGCTCGTGGTGGCGGCCGT
GCAGGTGCAGGGCGCGGAGGCCGCCAACGGGTCGCTGCCCACGTGGCTGGCCTACGTGACGGGCGGCCTGCTGGTCATCATCATCGTGTACTACTGCTGC
CGCCGCGCGCGCTTCGATGAGAACCTACAGCAGCCGCTGCTGGGCGGACAGTACACGGAGGACGGACAGCCCATGACACGCCAGGACGTGCAGGAGTCGC
ACGACGAGGTGAGCACCCAGTGGCAGTGCGAGGTGTGCGACTTCCACAACAAGAGCTCGGCCAAGGCCTGCGTGCTCTGCGGCACGGAGCGTGGCTTCAG
CCTCGGCCTCAAGTCGCCCGCGCGAGCCGCGCACACAGAGCCCGTGGCCGTCGAGACGGACGTCCCGAGGGAGAAAAGCTTCAACCGCACGCGCTCGTTC
GCCATCCGCCGCCTCAACATGCTCAACTCGCGCCAACGAGGCGCTAGGAACCGCCAGGACTGGGTGCGTAAGGTCGGACTCGACGGGAAGCGCTACTGGG
CCAAGCGGGAGCTGCCCTTCCCGCTGGGCAACGCCAAGCCCAAGGACGACGCTGAAGGGATTGAAAGCAAGATTAACGCTATCCGGATCGACGTTCCGGC
CTCGGACGCCGACATGCTGTCGCCCAAGGCGACCACGGCGTCCACGACGTCGTCATCAATTGCTGCGGATCCGGATAAGGAGCTGGTGCACCAGCAGTCG
CTGGCTTTCGTGTCGCAACTGGCGCAGACCCCCCGCC