Description :
From Genome Similarity Track
Location :
Scaffold_774:7157- 8193
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_774-fgenesh-gene-0.4Haloacid dehalogenase superfamily protein

Sequence
1036 bases(100 bases per row)
AAGTGGGTGGTCCGGTGGCACAATCCCGGCGCGCACCAGCCGCTCAATGAGCGTGGTCTCAATCTTTTGCATTTGCACGTTCACCAGACTTTCGCCGTCG
TGAGTGAACTGATCAGTTCGGATGGTCAAGAGTCCTGTCCATACAGAATCAGCCACTGATCAGTGCACCGTTTCCCCGCAAACAGCCACGCACCCACTGC
TCTTCTCCGCTCTTGCTATTGTTCTTCCCGTTCACATAGACGGAAGGAGACAACAAGGCGGGAAGCCCACAACTGGCGCTGACCGAATTTATATGAGTTC
ATGGTGGCCGCGTACCGTGGAGATTCCCAAACAACACGTCGGTCGAGTACCGGTCGCCGATCATCACGAGCTCCTGGGCCTCGGCGCCAAAGAATGCCTT
TACGTGATCAATGCCGTCTGGTTTCTACAGCACAACGCAACTATTCAACACGCTGCTGCTTGCAGGAAAGGAAGGGACCTAGCTGCCCAAAGCGGCACCT
TTTGGTTGTGCCGCAAGACGGCGCATTGCAGCTCCGCCTCGATCTGCGCCGCCTTGCGGAAGCCAGCGTCGTCGCTGGAGCCGGCCGAGTTGGAGAAGAT
GAGCACGCGATCGCCAAAGACGCGCTTGCATTCGGCAAACGATTTCTACCGTGGAAAACGAGTCGGTCAACATATATGAGCTCGCCGCTAATACCGTATT
AGTAATACGGAGAGCACGCGATGCAAAGCGAGAGGCCTGGAACGAACCTGAAGATGCGGTGCGATCTCGTGGTCGTGCGGCACGGTCAGCGTGTTGTCCT
TGTCAAAGACCACGCCCTTGAAGCCGCGATCGTGGAGCGCTTGGAACGAAATGTCATTGAGATCTGAAGCCCAGTGATTGTGCAGCCCAGAGAGCGAGTT
AGAGACGCGCGAAACCGGCATCCAGCAGCGGAATGAGCAGCGGCAAACCTTTGACGGACACGTGCGGCAGCAGCAGCTCGGGCTGGCGAAGCCACGCGCG
GCAAAACTCGGTCACGCCGCGCAGATTGAGCCCTTT