Description :
From Genome Similarity Track
Location :
Scaffold_1141:7156- 8673
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1141-fgenesh-gene-0.1Mitochondrial-processing peptidase subunit beta

Sequence
1517 bases(100 bases per row)
CGAAGGCGGCTGGGCGGAACGCGCTGAACCTAGTATCGGAGCCAGTACGAGCGACGACGGATGAAGTTGTAGTCTGGGAGCTCGTGGATCGGGCCCGTGG
CCGCGAGCGCGTGCTCCTTGTCGTTCACGACCTGGTCCGCGGCGTTGCGGACAGCGGCGGCGTCCACGGCGTCGATGCGGGCAAAGATCTCCGCGGGGGT
CAGGCGGCGGCCGTAGGTCAGCAGCTGGCGGCCAATGTCTTCGCAGATCGGCGACGAGCCGTCGAGCTGCATGAGCATGTTGGCCTTGAGCTGGGTCTTG
GCGAGCTCCACTTCCTCCTCCGTGGTCTTGTGCACCAGACGCACGAGCGCCTCCATGGTGTACCACGTCAGGTCGTTGAGCTTGTACTGGTCCGCGACCG
CGTACACGCCAAAGAGACCAGTGTCCTGGTAGCACGTGTTGAACGCCATGAACGAGTGCGCGAGCTCCTTCTCCGCGACCACCTGGCCCAGCTTGGACGA
CATGTTGATGCCTGCGCCCGACGTGCGGTCCCACGAGCCGAGCAACGTCTGCATGATCAGCAGCGGGAACGCGTGCTCGCTGGTCCAGCTGAAGCCCTCG
AACGCAATCGCCATGTGCGCGACCGGGAGGTCGTCGTCCTTGATGCGGACGTCCGAGCCGACGAATCGCACGGGCTCGAGCGTTGGCGCCACCTTTGGTT
CGGTCGGCAGGTTGCTGAACGCGTTCTTGGCCAGGTCAACGAGCTGCGAGTGGTCGACGGCGCCGGCACCAGCGACCACCATGCGTGGGGCGGTGTAGTG
GTTGGCGATGTAGTCCTCCAGGTCAGCCTTCTTCAGGTTGCGGATCTGTGAGTTGCAACAAAGCACATGGTTACTACGATGCCCATAGAGACAGGGCATG
CAATCTCCAAATACGTACGTTCTCGATCGGTCCGAGGATGGTGCGGCCAAGGCCGTTGCCCATGAAGGCGGTCTCGTGGAGGCGGTCAAAGATCACTTCC
TCCTGCTGCTTGTTGACCTCCTCCATCTCGCGCAGGATGACGTCGCGCTCACGCTCGATGGCGGCGTCGTCGAGCTTGGAGTTCTGCAGGATGTCCGAGA
GGATGTCGACCGCGCGCGGCACGTCCTTCTTGAAAACCTTGGCGTAGTACACGGTCTGCTCGCGCGACGTGTAGGCGTTCAGGTGGCCGCCCATGTTCTC
GATCTCGAGCTCGAGCTGCTGCTGCGTGCGCTTGGCCGTTCCCTTGAAGGCCATGTGCTCCAGGAAGTGGGCCGCGCCGTTGTTCTGCGCGGTCTCGTAG
CGCGAGCCGGCGCCGATCCAGACGCCGATCGTGGCGGTCTCGCCGTGCGAGCCCTCGGACGCCACGCGCAGGCCGTTGGCAAGCGTCGTGACCTCAGTGG
CCGGCGCGTTGAGCACGTAGGACGGGTACTTGAGGCTTGCGGCCGACTGCGCGCGCGCGAGCAGGCCCTTGGCCTGGAGCGGGGCGGGGCGGAGCACCTT
GGACAACATGCTGCTAT