Description :
From Genome Similarity Track
Location :
Scaffold_151:71551- 76263
Transcript NameFunction/comments
Physo_143778hypothetical protein

Sequence
4712 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAGAACTTTATGCAGGAGATCGGCTGGAGCTTGGTCTCCGCCAGCGCATTGAAGAGTACCTGGACGTCGATCTGCTACCTGACCCCGCTGTTCGGTG
CCTACATGGCCGACGAGCGATGGGGCCGGTTCCGTACGATTTTGACGTTTGGTATCTGGTACTGCGTCGGTGACTTCCTCGTCGCCATCGCCGCGTACCA
CCAACTCGGCTGTTGTGAACCCGATCTTCGTCATCGGTCTCTTCGTCGGCATTGGTGTTGGTACCGGTTGCATCAAGTCCAACGTCATCACGCTTGGTGC
TGACCAGTTCGACCCGCACGACCCGAGTGAAGTCCACCAGAAGGAGACGTACTTCTCGTACTTCTACTTTTGCATCAACCTCGGCGCTGGCTTCTCGTAC
GGTTTCCTGTCGATCCTGTGCGTGGATGGCTCGGCCCAGATCCCCGCGGAGTACGGCTACTTCGCCACGTACATGATCTGTGCCGTGGTGATGCTGTTCG
CCATTGCGATGCTGTGCGTGGGCTACCCTCGCTACGTCTTCATGCCACCGAACGACCGCTCCATCTCGATGCTGTGCAAGCTGGGCTGGGCCAACGCCAA
GCAGACCCGCAGCGGCTTCATCCTCGTGTCTGCGACTCTGAGCTTCCTGGCTGCTCTGATCGTCAACGTCATCTCCGCCTTTACGGTTGATAAGGGAAAC
ACGGGCAACATCCTCTCGTACGTCGCTGCTGTGCTGGTGCTTGCCGGCATTATCGGCTGGGTGTACTCCGGCCAGGAACAATCCTTCCTGGACGCGTCAA
AGGTCAGCCATGGTGGCACCTTCGACGACGAGCGCGTTGAGGGTTACAAGAAGCTGGTGCGCGTGCTGCCGTACGCCGCCTTCACTATTATCTGGCAGTG
TGCGTATGACCAGACCGACGCCAATTTCCAGTCCATTACCCAGCAGTGCGACCTGCGTCTTGACACGAGCGACCCAGACAGCTCGCAGATCCCTGGCGCC
ATGCTCGGTGTCTTCGACCCGATCGTCATCGTCATTGTCATTCCGATCCTTGACTCGATCGTCTACCCGGCGTACTCCAAGTGGGCCGGCAAGTCTCCCA
GTCAGTTCGGCAAGTCCGCAACCGGTCTCGTCATCGCCATCGTTGGCATCTTCTGGGCCGGCATCTTCGAGGTCATCCGTCGCAACGCTGGAGCTCTACA
GGACGAGAACGGGGACCCCATTTTGGATGGAGGTAGCTCTCAACCCATGAACGACATCTCGTGGGCCGCCGCCATCCCCAACTACATCTTCATCGGTCTC
GCTGAATGCCTGATCAACGTTACGGCGTACGACCTCGTGTACTCTTCAGTGCCGATGTCGCTCAAGTCCATGGCCCAGGCCGTGATCCTGTTCATGAGCT
CCATGGGCAGCATCCTCACCTCGGTCTTCACCATCATGTTCTCCAAGTCGCTTCCGTCCGACAACCTGAACGAGGACCACCTCGAGAACATGTTCTTCAC
GGTGGGTGCCGTGAGCGTCATCAACTTCGTCTTCTTCATTATCATCATGCGCAAGATGAACATGGGCATGTCCTCTTCACCTGAGCTCGACCACCTCGGT
AACGAGGTACAGGACCTCCTGGACGAGAAGCTGTCGGTGAGCTCGCGCCAGAGTGTCGCGGCCACTAAGTAAGGCCAAAAAGAGTATTCCGGTGGCTATC
AAACACGAGAAAATATATTGAGTGAGTATAAAACTTAGGTTAAGTGTTTCTTGCTGCAGCTACAGTGGGCTTTTGTTCTCCAACAATGCCAGGCAACTTC
GAAAACGAAGCGATTACACCAAAGAGCCAGGTTATGGCAGCTGAAGCGTTCCACTTCAGCTCGCGTGACGCAAACTTCTCTAGCTGCACCAAGTGCACGC
AGTAACCTACATCCAATGATGCTATCGATGCCACCACAGCCATCAGCAATAGTAGCACTACATGAAAACCAAGTGACGCAAGCTAAGCTCGAACGGCAGC
CGCGCACTGGCGAGGACGCTCGAGTTGTCAACGAAAAGCTAGCGTAGCCGCGGATATGCAACGCAGACGCTGGCGTGATCCAGGTCTCTTCGTGATTAAA
CAGCCACCAGAAGATTTTTCGTGCGGCCGGCGCTCGGATTTTAATCTCCTACGGTACCGTAGTTGACGCATGCAAACGTGGCAGTTGGATGAATCAAGCA
ACGGGGTATTGG