Description :
From Genome Similarity Track
Location :
contig_23:715432- 717143
Transcript NameFunction/comments
g5233.t1hypothetical protein

Sequence
1711 bases(100 bases per row)
TACATGGAGTCGATGGCGAAGGGCAAGACGGCGGATGCACTGTCGGAGCTCGCAAAGTTGCAGCCGAAGACAGCTTTGTTGATGCCAAGGGTAAACGCGA
CCGCGAAATCCCGATTGAGTTGGTGCAGCGAGGCGACCTACTGCGCATCCTCCCGGGCGCCAACATTCCGACTGACGGTGTGGTGATATCTGGCTCGAGT
TCGACGGACGAATCGATGCTGACTGGTGAGAGCATGCCGGTTGCTAAGAAGGAGGGTGACTACGTGTTTGGGTCGACGGTGAACCAGCAGGGCACGTTGG
TGATAGAGTCTAGCTGCATGGGCGGCGAGAGCTCGGCTTTGTCGCAAATCTGTGCTTTGATTGAAGATGCACAGCTGCACAAGGCTCCGATTCAGGCGTA
TGCAGACTGGCTGGCGTCGATCTTCGCTCCTTGCGTGCTGGGTTTGTCTGTCTTAACATTTACTACCTGGTTGTTGCTGCTGTCGATGGACGTTGTACCT
CCGCAGTGGAAGCTGGATCTCGGAGTGCCGATGGGCTCTGGCCATGCAGATGATTTCTTCTTGTCAATCCTGTTTGCGATCTCGGTTGTGGTGATAGCGT
GCCCATGCGCGCTTGGACTCGCTACGCCTACTGCCGTCATGGTTGGCTGTGGCGTCGGGGCCAAGAAGGGAGTGCTTATCAAGGGTGGCCGCGCTCTTGA
AACTGCGCGCTACATTGACACTATCGTGTTCGATAAGACCGGCACACTTACCGTTGGGCACCCTTCCGTGCGCGACGTAGTGGTGGCCGACCGCGCGTAC
ACGCCGCGCGAGCTGCTGTACTATGGCGCTTCGTTGGAATGCGTCAGTGAGCACGTACTGGGCAAAGCCATCGTGATGACGGCGACGGAGCACGAGAAGC
TGGTCCTACAGGACCCGACAGAGGTGCGTGTGGTTCCCGGCCGTGGTATTGAGGGCGTGGTGGCTGCCAGCGAGGTCACGTCACGTAAAACTTCCGCAAA
TGTGCTGGTGGGCAACTCGGAGTTCTGCGAAGAGAAGGGGATCGAGATCAGCGAGAAGATGCGTGCGCACATGCACGAGCTGGAGCTAGAAGGAAAGACC
GTAGTGGTCATATGCGTCGAGAGCAAGCTGGTGGGCGTGATTGCGTTGGCGGATGCTCCTCGTGCGGAAGCGGCGGCCGTCGTGCAGCACCTGAAGGCGA
TGGGCCTGGACGTGTGGCTGATCACGGGTGACAACCTTCGTACGGCCAGTGCGATTGCGCGGCAGATGGGCATCAACCACGTGAAGGCTGTGGCTCTGCC
CGGCGAGAAGGCGTCTCAGATCAAGGCGCTGCAGTCGCAGGTGAACCCGCTCACCCTGAGGCCGCGCGTGGTGTGCATGGTTGGTGATGGCATCAACGAC
GCGCCGGCACTGGCCCAATCGGATATCGGCATGGCAATTGGTGCTGGCACGCAGATTGCCAAGGCCGAGGCTGACATGGTTCTGGTGAAGAGCGCACTGA
CGGACGTGGTGGTGGCGTTGGACCTGGCTCGTGTGGTGTTCTCTCGCATCAAGCTGAACTTCTTCTTCTCCATCGTGTACAACTTCATCGGTATTCCGCT
GGCTGCTGGCATGTTCTTCCCGTTGATTCACCGAATGATGCCTCCTGCGTGCGCTGGATTGGCGATGGCGTTTTCGTCGGTGTCTGTGGTGATCTCGTCG
CTGTTGCTCAA