Description :
From Genome Similarity Track
Location :
Scaffold_74:71542- 73163
Sequence
1621 bases(100 bases per row)
TCGTATCTTCTGAGCCAAGGTAATCCCAGTATGACATCAAATTTGTCATCTAGATCCAGTACGATGAAATCATCATCGTACTGTTCACCCTCTAACGTGT
AGTGAATTCCAACTACACGTTTCTCAACGGTTATTGACACGCCTGTGGCAAGGACACCGTCATCATCGTTTGAGGGATGTCGCGCTCAACGAACTCGAGC
CTACGATCCTCTAGTGACTGACGAAGAACAAAGTTGGTTGACTGCCCACAGTCGACTAGAGCACGAAGTGACAAATCATTTGTCACTTGCAACTACAAGG
TGATGAGTGATATCTCATCACCAGGTGCAGAGACACACAATGATTGTGTATCTGGAGAAACTTTCGTCAAGTGATTTGCAAATTCTCTTGAGGTTGCTGG
ATCAGTAGGGCGCTCCGCCCCTACTGACCCCGACCATTTTTTGATGGTCCGCTTCGCTGTTGCGGTTTCGCAACAGCGTTGAACCTACGCCCATTGCCTT
CTTGGCAAATAGCCGATCATCTCGCTCAGTATTGTTTGGTACTGGGCGTGGGGCACTACACTCGTAAGCGTAGTGTCCCAAGTTCTGGCAGCGGTTGCAC
TTCTGCAATCGCTTGTTGTTTGAAGAGCGAGGTCTCTCGCTCTCAGCATAACAGAGGTCTATTGGTTCTGGACATCCAGTCTCTTGTCATCTCGGTGAAC
GATAACAGCTCGAGTTACCATGAGCCTGACTCATGCTAAAGTCCTCCTGTTCTGCAGCTGAGATTGCTTGTTCAAGCGTATCCAACTCTAAGCGGAACAG
GTGGTCCCTGGTGGGCCCATCTACGAGCCCTTGCATGAACACAGTAATCAATGTGTGTTCATGGACTGGGTTAGCAATTACACTACTCGCGAGGAGTCGT
ATGTGTTGAGCGTACGTGTACACATCACGCTTACCCTGCTTGAGTTTCAAGAGCTCTGACCGAGCCGTGAACTCAGCTCGTGGCGGCTCAAACGTCTGTT
TGAGCCGGGTTTTAAAGGCTTCCAGCAACTCAAAAGCATATAGGTCGCTCATCTCCAGTCCTAAGGCCCAAGTCTTGGCACGTCCCGCCAAGTGAGTTTG
AGCAAATGTGAGTTTCATTTGCTCATCGTAGATATGTCGTACCTTTATGGCTCTGTCTAGTTCGACGAGCCATAACAACAGGGAGTCTTCTTCGACTCCT
CTGTACTTGGAGATATCAACTTTTAAGATTTCGGGACGACGCGTGTGTGTCATCCCGCCCACAGCCGCATTGAATTGCTGCTGTCTCAACAGCTCTGTCT
GTTGAGCACAGAGTTCTCTCAACTGCTCGGCCTGTAAATTCCTTGCTGGTGAAGCAAGGCTACTTTCTCTCTTTCGGAGACAAGTTCATTTTGAATGAAC
CTGGCTATAGCGGCATGTTGTTGGTCTCTGTCAAGAGACTCCAATGGCGGTTTCTCCTACGGTAGAACTCATAGGTCCTACCGCACTCCATTCGATGTCA
CTCAAATGGGTATAGTCTTCACGCGCGGCGTGAAGACTCTCCTCCTCATCCAACATGTTCATGTCAGATGAGGTGGTTGTGGTCGCTGGAAGGACTACAA
AGTGCTACCAGGTGTAACGGG