Description :
From Genome Similarity Track
Location :
Scaffold_1035:7154- 8249
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1035-fgenesh-gene-0.4Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1035-fgenesh-gene-0.1Aspartyl/Asparaginyl beta-hydroxylase

Sequence
1095 bases(100 bases per row)
GTCGACACCAGTTCGTCCCGTGGCCAGCTCTGACGGCAGCGAGTCCACCGAGAGCTCATTCACGTCTGATTCTTCTTCAGCGGTATCACGGTCATCGACG
CCTTCGCGCGCACGCCTGAGCTCTACGACCACATTGTCATACCCGGTGCTGCTCGCTGCGGCTCGCATGACTTTGCTTGTTGTCAAAGGGCACGCGAAAC
GACGTGTCCGAGTCCGAAATGAAAATCAGAAGCGAAAACGATATGTGGGTTACGATTTATTAAATTCGCAGCTAGGGGCGCTCTATTTCAGATGTAACAG
TACTGCTTTGAGATATTTTGGCTGATCCATGGCGAATCGAAAATAATGGCGACGACAAAGGTGGTCCACAAGGCGGCGCTGCTGCGCTCGGCGCTCTGCG
TCACGACCGGTGCGCCCTTCACTCGTACATCCCCATATTGCTGCTGTTGTTCTACCCATACTCACCCATACTCTCGCTCTATCTATCTATATATCCCTCC
CAGCCAAGCCGCGCCCGACGCCGACGCTCTTTTTCTTCCCGGGACTCGAGTCGCGGTCGTGGCACGACGCGAGCAAGTTCCCGGCACTGCACCAGCTCGA
GGTGAACCGCGACGCCATCCAGCGCGAGTACCTGGCGCTGCGCGACCTGCGCAAGGCCACCGCCGCGGCGGGCAAGGACGCGGCGTCGGACTACAACGTG
AACGACCAGGAGCACCAGCTGCACCAGGGCGAGTGGGATTGGCTCTCGTACGTGACGCAGGGCCGGCGCCAGGCGGACTTTGCCGTCCACTGCCCCAAGA
CCGTCGAGGTGCTCGAGAGCATTCCGGGCTTCATGACGGGCCTGCCGTTCGCCTACTCGTTCTTCTCGGTGCTCAAGCCCCAGGTACGGATGCGGTTGAT
TGGCATCAAGAATCAGAATGGCTTGAAGCGGGTGGCTGATACTTTGGTATCAATTTGTGTATCGTTACAGTCGAGTATCAAGGCCCACTCGGCGCCGTGC
AACATCCGGCTGCGCTGCCACTTCCCGCTCTTCGTGCCCCACGAGGGCTGCGGCATCCGCGTCGGCGACGAGACACGGCAGTGGGAGACTGGCAA