Description :
From Genome Similarity Track
Location :
Scaffold_262:71532- 73358
Sequence
1826 bases(100 bases per row)
TGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCACGGGACTCTCCTGTTAGCAGATCCATGGATCCAAC
ATCCTCAGACCCATAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACTTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTC
TCCCAATAACCACGTGCCTCTCCTCTGTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGAAAACTCATCCACTTGGCGCAAACTAGAGACCTTGGCAA
CTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTACTACCTGGATCTGGCGATGTCTTGTTCACAAATGCATAAATGCAATACCT
AGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAAAATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCAA
ACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGG
ATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAGCACCTGACTTGTGCTGCC
CCGTCCATGTGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACG
CAGTTAGACAGACCCGACGGTAATCTTCAGGGTCGGAGTCCGAACTGTCGGATCCTGATTTAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCG
AGCTGGGGCCGTAGGCGTCGGAGCCTGTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACT
TCCTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACATGTTCCCGCA
GTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTGGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCG
AGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGAAACTGGAAAACTGCGCAGCAACTCTGACCACTTGTTCCTGGTAAAAATTG
CCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACT
TGACTTTGCTTATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCAGATATGGCTGAGATCCGTACCCTCTGGATCAT
GGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTTATCATGGGAGTTGTCT
CCCTATACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGAC
TCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACCGGATCCGTGAGGCGATT
ACCTTGAGCCCGATCTGACGATAATC