Description :
From Genome Similarity Track
Location :
contig_17:715288- 720431
Transcript NameFunction/comments
g4885.t1hypothetical protein

Sequence
5143 bases(100 bases per row)
TCGTATTTGAGGTTCCATCCCAGCGATCCAAACTTGCTGCGCTCTCGCGCAACCGCATGGAAGAAGCTGAGCCCAAACGCTAGACGAAGCTTCATGGTTG
TGTTCGAGGTTAATAAGTGTAGGCGGGAATCATTTCCAGCAGCGCTAGTTTGCTTCATCAGCATCATAGAGCGCAGCAAGTTTGCCTTTACCCCTGTTGG
CGACTCTGTCATTACCTTCACACTGTTTTGGAGTACTGAAATGGGAAAGTAAGCAACCGGGAAGGATGCCAGGAAAAGACGGAAGTCTTCGTGAACCGTG
CCGTTCCGCGCCTCTTGTTTAGTGCGGACTAGGAGAGCTTGCAACCGGGGTAACCACGATTGAGCTAAATGGACATTCTGAAGAACGAGCCAGAATCCCT
CCGCCTTGCATTGCTCCATTTTTGCTTCCACGATGGGTCCCTGACCCTGGCCAAGAGAAATAACATGATACCTGTCTTCCTCAACACCCTTTTCACGTGC
AAAACGTTCTAGTGCTGATATGGGATCTGCTCCAGGGGACAAAATAAACAAGCACGGCGTTGATTTATCCACGTCACGGAAGACATCACTCATCACGACC
TCGCCATCCGCTTCTTCTAGATACTCAGTGCCAAGTACTTGCTCGATGAAGCATTTCACCGCCACTGTAAACACATCCTCGCGCAACCAGCGCACAATAA
CCAGACGTAGGAATCGAGATACGTCTGTATCCCAATTTCCGGGTAAGCGAGCCAAATAAGGGTTCTCGCTCTCAATCCAGGTATTCCAGGAGTCATTATC
ACGGTAGTACGACTCCAAGAGTTTTGCGAAAATCGGTTGACTCCTAGAAAAGGCAAGGAAGACGCTCTCCACAGTACCAAGATTGTGCCTGAGTTCTCCT
GCGCCTCCAGGTCTGAACGTGTTTGTCCGTTCAAGTTTCGAGTGTGGTGCTTCGGTTGTGTTGGAAGTCATATCGCTGTTCAAGGTTGATGAGTCAAGAA
GACGGATATCGTGTTGGCTCATCTCATCAGCACTGATCATGATTCTTAGACAGATGACGAGAGCGAATAACTTCTTGTGTGCTTTAAAGAGGCCGCGACA
GATATTCCTGTATACAGCTAGCGTGATGTAGTGCTTGAGGCTCTCCAATCGTTCAGACAAGTTCCTTTTCGCGGGTGCCTCGTTCAAGCTCATGCTAAAC
AGTCTGTTAAAATACTCCAACGAGAATTGGTACATTGGGTCAACGTCTGCTAGGTCTGCGATGACGAAGAAGAGCATGGCACCACGTACAGCAACGTTGT
GGTATTGATTGCGGATCTCCAAAACCTCCAACTTAGTAGCTTCTGACTCCGAGAGGCGCTGTGCCACCATCGTAGATGTGTGTTTCGATGTTTTCAACGT
TACAATGAGCTCAACATCATCGAGGATATTCCCTTTCGCATCTGAAAGTAGGTTCAGAATCCTAACTTCCAAATCCTGTAGCTGCTTTTGATCCCGCGCA
ATGCTAGCCAGAAGAGTATGTTTTCGTTCTTCGACCTCCACGCGCTCTCGCTGCACGACGGCGCTTAACAATTGTTCTTCCAACCCGTCACTCGTTACGG
TAAAGTTGATAACATTGACTCGTATATACACATCAGGAGTGAAAAGTGGGTTCGCCAGCTTCGTGGTGAGATACAATCGGAAGAGCTCCATATCTGTTTC
CACGAGCCGATCCTCAATTTTTACATGCACTTTGTTGGCAACTCGTTTACTACCTGGCGAACGCTGGGATGGTTTTATTGAAAGTACAGGCTCGAGCGAT
GGATCCAGTGTCTCATTCATATCTTCGATCAGCAACGGTTTTCCAGAGGAGAGACAAGCTTCAACGACCTGCATCAAGCTCTTATCGTCATTTTTCACGA
TCTCTAAGTGATGAAATGCTTCAAGTCGCTTTATCCATTGAGTTGCTTGTTGTTGAGGGTCGATCATCAACGCCCACCGTCGCTTGCTTTTTAACGCAAA
AATCCCGTTATCTGTGGAAAATTTGTCGCTTGGAAGTCCCATAATTTGCCACTCCCGGAGCTCTCGAATGTCTCCGTACGCAGCAGCAAGGGTGAATGGG
GTCGACACGCCGATGGAGTCTCTACCGATATCAGTCCACCGAGACAGTAGTTTGTCTCGAAAACTACCATCGAACGGCGCCAAGTACGATATGCACGCAG
CTACAAGAAATGAGTCCCCCAAAATCGAGTTACCTTCTTGCTTGAGAAGCTTGATACTGCTCTTCCAACGCACACGCTCATCACTAAGGCCTTCCGTTAG
TTTTTGTGCGTTTTGTAGTCTCTGTTGCGTTAATTCAGATTCATCCAGTAATCGTTGCTTTTCTGTGAGGGTAGCGTCACAATTTTCCTTGAGCCGGCGC
ACCTTATCCAGCACTTTAGCAAGCTCTTGTTGTTTTGTTTCAAGCTTGGCATTCGCGATTTCTAGCACAGCATTCATTTCAGCCAGTCGCTGGCGCTTTG
GTGCTACCTCTCGGCACACACGTGCGTAGGTATCGATGGCGTGCACCCACATGCATAACGACATAGCAGCACGTGACACCTTTTTGACCTCATCGACAGC
AAACTCAGGGCTTTCGATGTACTTCCGAATCTTCTTCAGGATACCATTAGGAATGCTATCCTTATCATACTCCTTGAGCTCGGCCATAAAAGTACTCCTA
GATAAAATACGTTTGCTGTTATCCCAATCCACTTTCTCACCGAGCATGATACACACAGCCTCCATCACAACTTGTACAGCTTGGGGAGGTTTCACAAAGC
CCTTTACCTCAGTAATATCCTTTTTGTCCAGAGAATCCAAAGCTGCCACAGCTGCATTAAGAGCTGGCAAGGCCTGGTCTAGATCGCGTTGTGCGTCAGC
TTGGCATGCAGCAACTTCTTTCTGCTGCTGCTTGACGACAACTTCATCCGACCCCACTCGCTGGGCAACCTTTTCAGCTTCCACTTGATCAATCGCGACT
TGAAACAAAAGCTCTTCTGCTTCTTTCGTCTTGCTGGCAAGGAATGGTTGAAGCACAACTAGTTCGTCTTGGAGTGTACTTACAAGTGAGTTAGTCTCTT
CCAGTTTGACAACGCCTGCCATCAAGCGCAGCAATTTCGTTTCCCAGTGAGACTTCTTTTCCCGATAAATTCGTCGAAACAGTGCAATCAAATCCAAATA
GTTCTGAGACGTGATGTATACACGTCGTCGGCAATTGGCAAGAAACAATGGAAGAATAGCGCTCACTGATAGATGCGCCTCAACGCAAAGGGCGGTAGCA
GCTGACCGGATCACAGGTGCACTCGCCAGGTCAGGCGTAGTGAATTTTGTATTTACACTTTGCAATTGTCTTCACGGTCTTCTTGAGATAGAAAAAACTC
GGCAACATATTCAAGAGCGCTCTTTGGCCATTCGTCAAAGTAATCAATTGTGGTACAGTTGATTAGTGCTGGGAACTGGCGAACACGGGAGCGAAAAGCT
TCTGTTAGAGGATTCATGCAAATGACAAAATGAAGCGCATTATGCACCATCATGTGAAAGTAATCCTCACAGTCCTTTCGAGTGAGATCGCCGGTTTCTA
AGCTGCCATTAAGCTGGCTATTACCCTCTTGTGTCGTTTTCGATTCACCCATGCTGCGCTCAAGTAGCGTTCTTACATCATTGATAATCCTCTCGAGTTC
TTCCGTAGTGAAGAGTTTAGGAATTTCTGCACCGTTCAGAATCGTGTTAATATCTTCGAGAAAAGCGTCAGATGTCAATTGTGAATCGTTTAACAAGAAT
ACAGTCGGAATGGCGCTGACGCTGGAACCTTGACGACTGGGTCCAGCGTTTAACGTCCGTGTACTTCGGGCCGCTTTGCTGTGGGCATCTTTACTAGGGC
TTTCTCCCAACGCTGCTAGTTTCATCATCAGTTTTAAGTCTTCTCTGAAGTCGAGCAGACCATAATCCTTGATCAGCTCAATCTCAAAACAGTGATATCC
CGTCAAAAACGCAGCAAGTCGTGCGAGACAGCGCTTGCCACAGCCACCCATTCCAAGAAGTAGTGCGTGGCCTCGAGGCTGTATCAAGATCCGTGCGATC
GCAGCTGTATGAATCATTGCATCTTCAAAAAAGTACTAGCTCGAGTGGTGGATGAGACAATGATTTACCAAGTGGACTGATATTGTACTCAGCTATCCGT
CCATTCAGAAAAGCTTTGTAGCGGTCCAAATCGCCAACTTGATCGTATTTCATGACCGTAGCAGTGCTGTTCGTGGGTAACTCTCCTGGGGTTGCAATGC
GTCGTGGCGAAAAGAGTAAAGTGCTATGCCCAGATTTTGATGGACTGCCATTATCGCCACTGCTTTGTCGTCTGCGACGCTCCATCGTATGTTCTATACC
AATACCAATATCGACTGACCATGAAAGACCAAACACTTTGTTTGCGACTTCCACCAACTGCTGAGAGAGCCACTGTCTGTCCGTGCTGTCCATGAGGCGA
TCGCGAAACACTCGAATCCCTTCGTGAGCCCATAAATTAACTACGGTATTTGCCGTTAGGCTGTTCGTTCCTCCGTTCCTGGTGGGTGCTCCCGATACTG
AGTACCAAGCACAATTCCTTGCATGAGTTTGGTCACATCGCGCAAGTTGAACGTGTAATGACACTTCGATGGGGTTGGGAGTAAGCCTTGCACGACGCGT
TGGAAGAGTTCACATGTAGCATCTGCAGTCAACATCAGCGTATCTTTTACGTTTTTGGCGAATACACCGCTGCCCCCGCACGCCTTGATATGCGAAGCTA
AGATTGAGTTAAAAATTGCTTTCATCGCACCTTCATCACAACTAGGCAGACAGAATATAGCAGAAAACTGTCGTACAAACCGTGGGCAAAGCATTTGGCG
ACCTCCGCCTGGAAATCCACCCGCTGCAATAAGAATGGAGTCGTTGACATCCTTCCAAAAGAACTTGTCACGGTCGTAGAAACCTCCGTATTCCAGATAC
TGTCTCAAGAGCTCTATCACGGGTTGTGCACCGTGTTTCTCGGTGTTCGGCATGTTCACGTCGTCGACGAAAATGACGACAAGCTGCTTGTTCACAGGTG
CTCCAAGAAGAGTCCTGCGTTTCTTAGCGAACTTGCTCTCGAA