Description :
From Genome Similarity Track
Location :
contig_17:715238- 719329
Transcript NameFunction/comments
g4135.t1hypothetical protein

Sequence
4091 bases(100 bases per row)
GACGACGAGAGTGAATAACTTCTTGTGTGCTTTAAAGAGGCCGCGACAGATATTCCTGTATACAGCTAGCGTGATGTAGTGCTTGAGGCTCTCCAATCGT
TCAGACAAGTTCCTTTTCGCGGGTGCCTCGTTCAAGCTCATGCTAAACAGTCTGTTAAAATACTCCAACGAGAATTGGTACATTGGGTCAACGTCTGCTA
GGTCTGCGATGACGAAGAAGAGCATGGCACCACGTACAGCAACGTTGTGGTATTGATTGCGGATCTCCAATACCTCCAACTTAGTAGCTTCTGACTCCGA
GAGGCGCTGTGCCACCATCGTAGATGTGTGTTTCGATGTTTTCAACGTTACAATGAGCTCAACATCATCGAGGATATTCCCTTTCGCATCTGAAAGTAGG
TTCAGAATCCTAATTTCCAAATCCTGTAGCTGCTTTTGATCCCGCGCAATACTAGCCAGAAGAGTATGTTTTCGTTCTTCGACCTCCACGCGCTCTCGCT
GCACGACGGCGCTTAACAATTGTTCTTCCAACCCGTCACTCGTTACGGTAAAGTTGATAACATTGACTCGTATATACACATCAGGAGTGAAAAGTGGGTT
CGCCAGCTTCGTGGTGAGATACAATCGGAAGAGCTCCATATCTGTTTCCACGAGCCGATCCTCAATTTTTACATGCACCTTGTTGGCAACTCGTTTACTA
CCTGGCGAACGCTGGGATGGTTTTATTGAAAGTACAGGCTCGAGCGATGGATCCAGTGTCTCATTCATATCTTCGATCAGCAACGGTTTTCCAGAGGAGA
GACAAGCTTCAACGACCTGCATCAAGCTCTTATCGTCATTTTTCACGATCTCTAAGTGATGAAATGCTTCAAGTCGCTTTATCCATTGAGTTGCTTGTTG
TTGAGGGTCGATCATCAACGCCCACCGTCGCTTGCTTTTTAACGCAAAAATCCCGTTATCTGTGGAAAATTTGTCGCTTGGAAGTCCCATAATTTGCCAC
TCCCGAAGCTCTCGAATGTCTCCGTACGCAGCAGAAAGGGTGAATGGGGTCGACACGCCGATGGAGTCTCTACCGATATCAGTCCACCGAGACAGTAGTC
TGTCTCGAAAACTACCATCGAACGGCGCCAAGTACGATATGCACGCAGCTACAAGAAATGAGTCCCCCAAAATCGAGTTACCTTCTTGCTTGAGAAGCTT
GATACTGCTCTTCCAACGCACACGCTCATCACTAAGGCCTTCCGTTAGTTTTTGTGCGTTTTGTAGTCTCTGTTGCGTTAATTCAGATTCATCCAGTAAT
CGTTGCTTTTCTGTAAGGGTAGCGTCACAATTTTCCTTGAGCCGGCGCACCTTATCCAGCACTTTAGCAAGCTCTTGTTGTTTTGTTTCAAGCTTGGCAT
TCGCGATTTCTAGCACAGCATTCATTTCAGCCAGTCGCTGGCGCTTTGGTGCTACCTCTCGGCACACACGTGCGTAGGTATCGATGGCGTGCACCCACAT
GCATAACGACATAGCAGCACGTGACACCTTTTTGACCTCATCGACAGCAAACTCAGGGCTTTCGATGTACTTCCGAATCTTCTTCAGGATACCATTAGGA
ATGCTATCCTTATCATACTCCTTGAGCTCGGCCATAAAAGTACTCCTAGATAAAATACGTTTACTGTTATCCCAATCCACTTTCTCACCGAGCATGATAC
ACACAGCCTCCATCACAACTTGTACAGCTTGGGGAGGTTTCACAAAGCCCTTTACCTCAGTAATATCCTTTTTGTCCAGAGAATCCAAAGCTGCCACAGC
CGCGTTAAGAGCTGGCAAGGCCTGGTCTAGATCGCGTTGTGCGTCAGCTTGGCATGCAGCAACTTCTTTCTGCTGCTGCTTGACGACAGCTTCATCCGAC
CCCACTCGCTGGGCAACCTTTTCAGCTTCCACTTGATCAATCGCGACTTGAAACAAAAGCTCTTCTGCTTCTTTCGTCTTGCTGGCAAGGAATGGTTGAA
GCACAACTAGTTCGTCTTGGAGTGTACTTACAAGTGAGTTAGTCTCTTCCAGTTTGACAACGCCTGCCATCAAGCGCAGCAATTTCGTTTCCCAGTGAGA
CTTCTTTTCCCGATAAATTCGTCGGAACAGTGCAATCAAATCCAAATAGTTCTGAGACGTGATGTATACACGTCGTCGGCAATTGGCAAGAAACAATGGA
AGAATAGCGCTCACTGATAGATGCGCCTCAACGCAAAGGGCGGTAGCAGCTGACCGGATCACAGGTGCACTCGCCAGGTCAGGCGTAGTGAATTTTGTAT
TTACACTTTGCAATTGTCTTCACGGTCTTCTTGAGATAGAAAAAACTCGGCAACATATTCAAGAGCGCTCTTTGGCCATTCGTCAAAGTAATCAATTGTG
GTACAGTTGATTAGTGCTGGGAACTGGCGAACACGGGAGCGAAAAGCTTCTGTTAGAGGATTCATGCAAATGACAAAATGAAGCGCATTATGCACCATCA
TGTGAAAGTAATCCTCACAGTCCTTTCGAGTGAGATCGCCGGTTTCTAAGCTGCCATTAAGCTGGCTATTACCCTCTTGTGTCGTTTTCGATTCACCCAT
GCTGCGCTCAAGTAGCGTTCTTACATCATTGATAATCCTCTCGAGTTCTTCCGTAGTGAAGAGTTTAGGAATTTCTGCACCGTTCAGAATCGTGTTAATA
TCTTCGAGAAAAGCGTCAGATGTCAATTGTGAATCGTTTAACAAGAATACAGTCGGAATGGCGCTGACGCTGGAACCTTGACGACTGGGTCCAGTGTTTA
ACGTCCGTGTACTTCGGGCCGCTTTGCTGTGGGCATCTTTACTAGGGCTTTCTCCCAACGCTGCTAGTTTCATCATCAGTTTTAAGTCTTCTCTGAAGTC
GAGCAGACCATAATCCTTGATCAGCTCAATCTCAAAACAGTGATATCCCGTCAAAAACGCAGCAAGTCGTGCGAGACAGCGCTTGCCACAGCCACCCATT
CCAAGGAGTAGTGCGTGGCCTCGAGGCTGTATCAAGATCCGTGCGATCGCAGCTGTATGAATCATTGCATCTTCAAAAGTACTAGCTCGAGTGGTGGATG
TGAGACAATGATTTACCAAGTGGACTGATATTGTACTCAGCTATCCGTCCATTCAGAAAAGCTTTGTAGCGGTCCAAATCGCCAACTTGATCGTATTTCA
TGACCGTAGCAGTGCTGTTCGTGGGTAACTCTCCTGGGGTTGCAATGCGTCGTGGCGAAAAGAGTAAAGTGCTATGCCCAGATTTTGATGGACTGCCATT
ATCGCCACTGCTTTGTCGTCTGCGACGCTCCATCGTATGTTCTATACCAATACCAATATCGACTGACCATGAAAGACCAAACACTTTGTTTGCGACTTCC
ACCAACTGCTGAGAGAGCCACTGTCTGTCCGTGCTGTCCATGAGGCGATCGCGAAACACTCGAATCCCTTCGTGAGCCCATAAATTAACTACGGTATTTG
CCGTTAGGCTGTTCGTTCCTCCGTTCCTGGCGGGTGCTCCCGATACTGAGTACCAAGCACAATTCCTTGCATGAGTTTGGTCACATCGCGCAAGTTGAAC
GTGTAATGACACTTAGATGGAGTTGGGAGTAAGCCTTGCACGACGCGTTGGAAGAGTTCACATGTAGCATCTGCAGTCAACATTAGCGTATCTTTTACGT
TTTTGGCGAATACACCGCTGCCCCCGCACGCCTTGATATGCGAAGCTAAGATTGAGTTAAAAATTGCTTTCATCGCACCTTCATCACAACTAGGCAGACA
GAATATAGCAGAAAACTGTCGTACAAACCGTGGGCAAAGCATTTGGCGACCTCCGCCTGGAAATCCACCCGCTGCAATAAGAACGGAGTCGTTGACATCC
TTCCAAAAGAACTTGTCACGGTCGTAGAAACCTCCGTATTCCAGATACTGTCTCAAGAGCTCTATCACGGGTTGTGCACCGTGTTTCTCGGTGTTCGGCA
TGTTCACGTCGTCGACGAAAATGACGACAAGCTGCTTGTTCACAGGTGCTCCAAGAAGAGTCCTGCGTTTCTTAGCGAACTTGCTCTCGAA