Description :
From Genome Similarity Track
Location :
contig_6:715221- 716303
Transcript NameFunction/comments
g1895.t1hypothetical protein

Sequence
1082 bases(100 bases per row)
AGCAAACGAAGATTCCGATGAAAGGTTCACTTCTGCGCCAGGAATGCACGAACCTACTCAACCGGGAACTGGCACGCATAGAAAAGCTTCCAATGGGTTT
GCAGGGCAAGCGTGGAGTTGAGATTGAATGCGGCCGTATTCGACAGAATGCAAGTCTACTCTTTGATAAGTTGGAAGTAGCGAACGACAAGGCTATTCAT
CACGCTTCGGCAGCGATGAATGATATGGTGCGAGCAGCGAAAGCCCGAATGAGCTCGGAGCTGCATGACAACCTCGATAAACGATTCGCCGACAAATGTC
CCGTTACGGTAACCAAATTGCAAAGTGAGGTGGAAGTCCTTTTCACAAGGGTAATGAACGAAGTGATGCAGACAGCTGGAAACGTCAATGAGTACAACAC
GTCAGACTTCCGCACAGACCTCGAGCACCACAAGGCGCAATTGGCGGATGAGATGAACCGGCGTTACATGATTGAAATGCGCCAAATCTTGAACGAGGTT
TGCTACGGCGCTAGGGAGGACTTAGGAAAGCAAGTTATGTATCATCTTGATGGGAAGTTGCCGCTGCTGGAGGAAGAAATTAAGGCTGCGATTGACAGTG
CTGTAGCTCACGTCAAGGGAACCATGGCCGATAAGCTTCAAGGGTGGACGATCCTCAAGAGCGATCTTGAAGCAAAGGGCATAGAACTGGAGAAGCTTGG
GGATGATGTAAGTGAGCACGTATGTCTGCTGTTGTTGGCTGGCAACGTAGTAGATGCTTAGAATTGGGGTTTGTGTTGTTTCGTGTTTTTTACAGTACGC
GGATAAGTACCTGCACCGCAACCAGCAACTTGAGAAGGACGCAGGCGTGCAAAAGGAAACCGAGCAGTACGAGAAATTGCGCATCAACGTAACGAAAGCG
TTCGAGGACAAACTCAAGGAGATTGGGTTTCCCACCACCGATGATGAAATCGATTCGGTGTTTCGCCATGTACTGCAGGGACTTGCTGCAAAGTTTTGTC
AAGTATAGTGGACAACAAGACCACTAGCTTCAATGCGAAGGGCCTGCGCGAGATTCTTACCAGTGATTGCAGACCAGCCGTG