Description :
From Genome Similarity Track
Location :
Scaffold_889:7151- 10810
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_889-snap-gene-0.4DEAD/DEAH box RNA helicase

Sequence
3659 bases(100 bases per row)
CCACTCGCTCGCTCTTTCTGAGCCTATTGTTCCATTGCGCGTAGGAGGCCGAGAAGAGAGAGAGACCGATTGAACATGCTCGACTTTCCGCTGCACGAGG
GTTTTTTCCCGCAGATCGCGTTGAGCGCGGACGAGGTCAGGTATTACAAGCGCCTGGGCAAGGAGCGCGTGGCGCTGCTCATCCGCGTGATCGAGGATGC
CGACTGCGCGTACAAGTGGACGGATGTTAAGCCCAAGGGCTCCAGCGGCGGTGCGGGCGGCGGNNNNNNNNNNNNNNNNNNNNNNTGGTGTAGCTGCCGT
GCATTGCCAGAAGGCGCAGTTCCTCGACTTCCAGCCGGCGAGCAAGACGACCGTGGCGTCGACGCTCATCAAGTGCAGCGTGCAGATCCCAGACGCGCGC
GTGGAGGAAATCCTGAGCGCGATCGCGAAGAGCAAGACCAAGGACTTCCGCAAGACCATGAAATACATGCACGGCGCGTCGTTCGTGGATGGCCGCACGC
TCTTCACGTTCCCGTCGTCATCGTCGTCCAGCGCGCGCGTGCGGCCGGCGTACAACTACCGCGCGATCAAGTGGCACGTGATGAAGGGCAAACAGCAGCG
CAAAGGCGCAGACGCCAAGTCGCTCGACTTTTCCTATTTAGAGTACGCCGGCAAGCGCAAGCCGCCGCCGGGCTCGAGCGTCGTGGGCTTTTGCGTGCAG
GAGTCGATCGCGCGCGAGCGGGAGATCCCGACGCTCGACAGCTTCGGTATCGCGCGAGGGTACCTGTCGCGCACGGGTATCGTGATCTCACGCACCCACC
AGACGAACGTGCTCAAGGTGACGTCTATTTGCCAGATCGACGGCGACCTCAACCCGATGGTGCGCAGCGTGCTCGAGGAGCTCATGCAGGAGAGCGTGTG
CGCCGTGCTGCGTGTGCAGGGGCTACTGGAGCGCCAGCGCGTGAGCAGCCTGCGCTTCGTGGAGCAGTGGCAGTGGGTGCCCAACTCAGACCGCAAGGCG
TGTGCCGTGTGTTTGCGTGGCTTCTACTTCCACCGCAAGCACCACTGCCGCACCTGCGGCGAAGTGGTGTGTTCCAGCTGCGCGCCGCTACGAGAGCTTG
AAGAGCCGATTTTCGACATCACCCAGCTGCGCGTCTGCTCCGTGTGCATGGCCAGCGCCAGCACGAACTTCAGCACGCATCTGCACGCCGGGGTGGGCAC
GTCGGCGAACCAGGAGTCGTCGACGTCAAACGGCGATACCGAGTCGTACATCCGCGGACTGCGTAGTCCGCAGCACAACTCGTACGAAGACATGATGTTC
CAGATGCGTGAGACGCGCGACCGAGACCGACGTGGAAGCGACGCCGCACAGATCGTGCTGGAGGGCGTATCACCGCTCAAGGAGCGACACCAGGCGCCAT
CAGTACAGCAACAGCAACAGCAGCAAGGGCAAGGACAAGGAGGAGGAGACAAGTACAGGGACATAGCGATCGTCAGGCCGCAGGAGAAGATGCAGGCACT
CACGAACGTCGTGAGCCACATCCGCGACATCCGCGACACGATCAACATCAGCATCTCTGAGGTAGACTTCGAGAGTGGTCTGGGCGATGGCGATGACGGC
GGCGGCGACGTCGACGACGAGATCTTCAGCGATGTGCGCTCGCGCATGCACAAGATCCGCGAGACGCTCGAGAGCTCGGTGCATAACTTTGACGCCGCGC
TCGCGAATGCCACACACGCGCCAGTGTACCCACGCACGCGGAGCGCTCGCAATGTCCTCACCAAGAAGAACCTGAACAGTGTTGCTGCTGACAGCGAAGT
GGAGCAGAGGGGGATCCTGGGTTTGACGAAAGGTTCCGACGATAGCGGCAGCGACGACAACGTCATGACACCCGAGCAGTTTGCATCAGTGGCGCGGATC
ACATTTGCAGCAGCGCGCGCGACCAAGCAGGCCGGTGAAGCATTCCTTTCCTCCTGCGGGTCCGATGCCGGTCGCAACTCGGACCTCGACGACGCATCGG
TGCGAACGCCAGACAGCTATGTGACCGGGTACAGTGACGGGAGTCAGGACCCGTACGCGTCGTCCAACTACGAGCGGGTCATGGCGTCGTATCAGGAGGA
AGAAGAGGATGACGCTGTCGGCAAACAGTTTTACGACATGCAGCAGAACCAGCAGTCGCCGCTTCTGAAGCGGAAGAAGTCGATCAACGTGAATCCGTCA
TCCACGAGACGCGCGAGCGAAATCTTTCAGCTGGAGAGGAAGATCGAAGAGCTCCAGCGCAGCTTGGAGGACGCCCAGCGGAAGTTATCGGTGTTTGAGA
TCGACGAGCCGGATCCGGAGCAGAAAGGGCCGCTAGAGGTTGTTTATGAGGAGTCTGCGCAGGTGGAGATCGAGAGCGTCTTTGAAGTGTTTGGCAACCG
CAGCGACTCGAGCAGCGTCGCGAGGGAGTCAATCACAGTGCGGTCGTCGCTGTCGAACGACAAACTCGTGACGACATACGACTTGGTGAGCGAGTTGCGC
GGCGTGATGAACTCGAGCGAGATGACCAAACCGACTGGCCGCCGGTCGTTCACGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCACTGGAGCA
CCAGCACTACCACCAGCAGCAGCAGCGCCAGAGCCTGCCGTCTTTCGGCGCAGGGTCCATCATGCCGTCGCCTATCCCACACAGAAAGAGTGGGAGCCCT
TCACAGACAGGATCTTCCGACAGCGACAGCCACGACAAGGCAAAGCACGCCGATCTGATGGACAACACTGCATCGTCATCGGCTTCCGGTCCGCAGGGTC
ACAGCTTCACGTCTTCGAACGGCGTGCTTGTCGGCAGCCACGTGAACGCCGACACGAGCTTGGAGTCTGCGCGGTATCAGCTCCTCATGGGTTCCGCTCA
GAACCTCCTCGCTGGCGTCGACATCGAGGATGTTGATGACGACGATTCCTCCGACGAGCAAGACGACGACGACGACCAGTTTATCATGATGGGGACCCTC
GACGAGCCGAAGCTGCGTCTCCGTCCCGCCGAGTTCGTTGAGCCGCCGTTTTTCTCGAAAAGCGAGCTGGAGCCGCCCGAGTCGCCCGAGATGAAGCGCA
AGCCTGCAGATCGACGATACACAGTGGGCGAGCGCCACGACGAGAGCGAGGAGCTACGCAAGCTGATGGAAGGGCTGAGTCGCCCGCGCAGTAACTCGGT
GCCGTTCGGTTCGAACCAGCTCGGCGGCGCGCCGACGTCGGATGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAGCCCGCGTGGAGCGACAACG
TGCCGAACCGCGCGCAGAACTCGTACCACATCGAGCAAACGCTGCGCGAAGTGCGCAGCTGCCTGTCGTCGTTCCTGGTCGAGTGTCCATCGGGCCACGA
GCGCGAGCGCAAGCTGAGCTCGATCTTCAAGGTGCTGCGCTCGCTGCACCGCGAGGGCGTGCGCTCCAAGTTCCGCACACTCAATCACGACGACATCCGG
TACACGAAGGTGCTCAAGGAGACACCGAGCATCATCCGCCTGCTCAAGCTCGCTGGGTACGTGTCGCTGCCGCAGAAGCTCACAATGCGTCGCGTGGACC
AGCCGTACATCGGCGTGATCCTGCGCGAGATCCAGGCCGACCTGAAGCACTAACATGCC