Description :
From Genome Similarity Track
Location :
Scaffold_75:71503- 74806
Transcript NameFunction/comments
Hyaar_Emoy2808173hypothetical protein
Hyaar_Emoy2808174Replicase

Sequence
3303 bases(100 bases per row)
CTGATACATTGACGGATCGTGCGAGACTGGTACTGATACCGCTACGTTCTATCCCGCAGCGCGACACGTGGTAGGGAATGACCGGTCGACTTTATCGGAT
CGAGCGGCACAAAAAAATAGAGGCTGGTGTCTGTATGAAAGGGTCTGGACACTTGTCTAGTTGACATGGTGCTATCCTGTCCGTGCCAGAGCCGGCTACC
AATGATTATTGTGAAAGCTGGTCTAGTTGAGACCCACTCTGTACCTGGGTGCGGTCTATCTAGGACGGGGAAGGGCGTTAAAAGCGCAGACTCTTCTTGC
TTCTTTCTACTACAAATGCATGTGCACACTTTGGTAGATTTGTGGGGGTAAACAGTGCGCTCTTGATTCGGGTGCTGATGCGATGAGGCGGTGTGTGGTG
ACAATAAGACCGTTGAGTCCGTAGTTATTAGAGTGAGACAAGATCTGCGATCATGGCGGATTCACCAGCTTTAAAATAGAAGAGTCCGATTTTATAAGAA
TTAGATCCTGCTCTCGTTGAAGCTGATGGCGCTCCTAGTGTCGTGGCATGTAACGGAACGTAACAGTAACACCCAGTGAGGAAACGTGACGTTCGCCAAA
GTGAGTCGCATTCTACGCACGTGGATTGATTCTGTGGCGAAGAAAACTAGCTGTCGGTCCATGTACGTTAGCACCGTGCAGGCGCTTTGCTCTTTAGGTC
GCAAAGGCCCATTCATATTCCGTGCTAGTGCGATCGCGGGTCATGAGAGAGTTTTGTTTCATAAACGAGCTAGCACCAAGTACAGCCATAACCTGCTACT
ACCGCAGAACATGCTGCTTCACGCACCTTCACAATGTCATGAAGCAGCTAATTGTCTCCTACTGATGCAAATATGACAAGAAATATGGATTCAGGTACAC
AAAAATGATGGGCTCCCGTCTTCTTAAACTCGCTCGATAAGGAAAGGAAGACCAAGACTGCGCATTCGCCCTCTCGCACTATAGTGCTCCGTTTGCAAAC
AATCGGAATTCGTGAAGGCTGGGCGCCATGTTTACTCGCTCATGCACACTATAGATGCTGCAACCGAGTGTTGATGGCACGTGAGGTGCTCCTCATCAGA
CATGACAGTACTCACAATACATAAGGCTGAATGAATCGTGTCCAGGCCCTGTCGGATCCCGTTCACCTTGTAGATACGTCTTTTACTCCACAGGTTTTCA
GGTGCTTGTATCCGGTTTAGCGACGCAGATAGCTCTCGATTAGTCGTAGCGGGCGCGATGCGTCCTCGATCTGGCGAAAGATGAACGCATTCTCAGGTGG
TGCAATAGCCTCGTCAAACACGTCCGCAAACATGGGGTCCCACCAATCTTCTGCAAACAAGCTGCGCATCGATTCGTCTGTGGCAGGAGAGATTGACACG
AGATCCAGCTCCCGCACGTGGAAGCTCGTCACAGAAGAACTGCGTCTCGATAGACGGTGCATCTGCCGCTTTGGTGCTGCAGCTCCTACTTCCGTCGACG
ATTGTCGACCATTACTGTACATCTCTTCATCTTCAGACGTCCGAACGTTCGCTTCTGTCACGTGGTCTTCATTCACCATCAAGAACTCCCGAATGAGGTC
CAGAACAGGACATCGCCCGTCCTCCATATCGTCGCAATCCAGCGTCTCTCCCTCGTCATCACCGTCTCCGGACTCTTCGTCGCCCAGTAATCCCTGTGTC
GTCTCTAGTAGAAACCGCATGTAGCTATCGAGCTCCTTTATTCTTGTGGCATCCAGTCGCTTCTTGGAAAAGCGCAGACCAGACTCGAAAATGTGGCGGT
CTGGGAAGCGCACATTGCTGTAAAAGGTCTCGAGCTCTTCGCATGCGCCACAGCTCGAGTGGCCTCTGTTGCTGTTATGGCCGCCATTGAAATGGCGCCC
GAGCGTCTCGTGCAGAGCGCGGAACTCGGAGTAGCGCTTGGCCACGTACCAATCGCCAGTGCCACTGCGAGTCACACGTAGCACATAGAGCGTCGGACAG
CGTCGAGAAGAAGTCTCGCGGCCGTAGGAGATTATTTTGGCCGAGACGGGGCGCAGCGAGCGTAGTTGGAAGATGGACGAGCAGCGCTTTACCGTTTTTT
CGAGCGCCGTGGGCGTCGTATTGGCTTCTGACATGTGTAGCACAATAGCTTTTGAGAAATGAGAGACTCAAGTTGAGGTGCCGTAAAGGGGCACGTGATG
ATGCCTGCTGTGTCACGAGGGACAGGAGGCGTGCATAAACAAGACGACAAGCACACTTTAGTCAACTGATTATCAGAAGCGGTAGCCAGAGTCGTAATGT
ATGTGTATTGTAGTATTTCTCACAGCGAAATAGTGTGCAGACATTCCGAGAGGGGCTGGCCGTTGTACATCTTGAGCAACTCCAAGATGACACACTCGTC
CAATTCACGGCGAATAGAGCTCATGAGATTACACAGTTTGCTGATAGACGAGCTTTACGAAATGACGCAGCGGATTTGTGGCCCCCTCATTGTTTAAGCT
GACTCATGCCTTCAGACTACACTACGACGATATAGCCGTACGCATCAAGTATAGCAGGTGATTACTGGTCTTTTAGCGCAGCGATTACAACGTGATGTCT
CGTTTGTCATGATTTATTTGCAGGCTGCTCGAACCGTGAAGAACTCGCTGGATGCGCTGTGTCGAGAAAGTACACAGCCGTTGTCGCTAGTAGTATACAT
AGCTCTATTTATGTGTCTTCTTAATGTTCCCAGCAAAGATTAGACGCTCTAAATAGGACAAATGCTGACAGACCTTCGCACGCTCAGCAGTAGAATCTTA
CAGAGCGGCCTTACTGGGAAGCTAGATGTAGAACGAGGTCGATGAACGCTGCCCACTACAGTACCCACTGTGCAAAAATCTCTATAATCACGTGTAGGCT
TCTGCCCCGATAGCAAATGGCCTTGCCAGATGCTGCCTCGTCTGAAGGCGGCCCTGGTCAGTACTAGCCCAGATGAAATGTATGAGGTAACGAGAGCTCG
CGCACCGATCAAGGCTCGGCGCCTGAGCTACTGCAAAAAAGTCCCGCCGCTTCCAGCGACAAAATCCTTCAACCAAGACGCAGTGAGAGCAGTATGTGTC
GATTGAATTGGAGGCTGAAAGGGCACGCGAACTTCAAACGTCCTAGCTCAATTGTAACACTCATTTTGCTATGGTAGCTGCTGCGACAACAAAGACAAAG
ACGGAAGATTACTCTGTCCCAACATTATCGCTAAAAACACAAGATTTATAAAGTGTATTTACATCGTACAAAAATGCGGTTTCGAGTTGATCGTGGGCCA
TTA