Description :
From Genome Similarity Track
Location :
Scaffold_928:7150- 8942
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_928-snap-gene-0.9Tubulin-tyrosine ligase family

Sequence
1792 bases(100 bases per row)
TGTTGGTAAGGTGGATAAAGAGGTTGGTCAAGTCGCCGTCCTCATAGGCGCGTGTACACATACGAACGAAGCCTTCCTCGTAGAAGAACGCCTCGAGTGG
ATTGAACGACGTCACGAGTACGTACAACCGCAAGTCAAATTTAAAACCATCGAGTAGCAAAGGGTTGGCGATGTACTCTTGAATCACGACCTGTTCCCCg
TACACAACGTGCGCAAGATCATTCACGAGGGAGATGCCTCGACCACGTGATAGTGCCACGGGTTTCATGATCCAAATGTTCTTGCCGGGTGCCACGACAC
GATTGCGTTCCTGGAAGGCCTGTACGAATGGCACATACTCTTGCGGgAGAaGGAAGCTctGAGGAACGATGTCGTACGCCTGCTTCAGCCGTCCGCCCAC
TGCCTGGTACTTGCCGATGTTCTTCTTGAGACAGtCTTTTCTCGTGAGcGCCTTGGCGTGCTGGAAATGATTCACTTTTTGCCACGCGAGCAGTGTCTTG
CGCTCAACGTTCGGTTTGCTCCACGTCCACAACAAGTTCCACGTTGTCTTGAGTCCCAGTCCCGACGGGTGCTCTTCCCAGTCTCCtAACTTCTCCAGTG
CAGTGACGACGATGTCACTCACTTCTTTACGAGTTTGAGAATTGATTCGGTAGTGTGCGGTGTATGGtGAAGAAGCTGATGGCGTGAAGAGaCCGTCTGG
TGTAGGGATGGAGCTCCCAAACACGGTCGCATAGTCACTCATGATCGTCTGCCAGCTCTGGTACAGTTTGAGCTGTAGTCGAAGCGCCTGTTCTCCTGTA
TGAGACGtATTTGCAAGAAGCGAAGACGAAGAAGGAGTGGTGGTGCTGGAGCTGGAGGTGAATGCCATGCGCTGCTCGTAGACGCTTGTCAacATACAGA
AGAAATTGGCAAAGTACCCTCTGTAGTCCTTCACGTCTTTGGTCATCGGACGTGGCACAGGAGATGGTTTCGACAATGGaCGTTTGGAACATTtCTTGGG
tGTTCTTGCAGACGACGTGcGTAGAGGCTGTGGCGCCAATACACCTACTGcATCCTCCTGCCTCTCATCAATAACTTCACcAGTAGTAGGCTCGGAGGTG
GTTtGCTTTGGGGTCTCAGGAGTAGTCATCTCTAGTTGGtGGTGCTGCTGTTCTTCACGCTCACTCCTCAGTCTCTCGAGGGCCGTTTCGGTCCGCTCTG
CGAcGAAGAGCTGAAGCTGTGCAGCAATTTCGTCGCGCATACTCaGcTCGGCTGTTtCTCGAAGGGTTGATTGATCGATCTCTGATGGTTGAGGGCCTTC
ATCTtCAGGATGAGGATCCTCCAAATACGCAGTCTCTGGTTCTTGAGGCACCATTTCCTGCAGCACCTTCACTGAGCCTTCAACTACTTCTTCACTTtcG
TGCTCTTGATCAACGATTCGTTCTTCTTCTACGGTGATAGGTTTCCCCTCATCATCCCCcTCCTCCTCTTCACTTGACTCAGCTTCTTCTGGTTCTTCTT
tCAGTTCCTCTTCTGGCATCTTCACGACCACCTCCATAGCCATGATCGCaGTCTCCTCGTCGGCGTCGTTCTCCGAGCAGTTACTCACGTCGCTCCCTTC
ATCACTGTCGCTTCTGTTGCCTTTTtgTGGAGTATCCAGTGCTCCGGCATCGACAAAACCCGTACTtCCGACaGGgTCTCCATCAATAATCGTCACTGTT
TCCACGTGTTTGCGCCTCCGATTCTCGGCCTCCTGCTTCTTCTTCGCTTGTAGCTCTTGTCGCGCCACAAGTCGTTGGTACGCCGCctGCCG