Description :
From Genome Similarity Track
Location :
Scaffold_769:715- 3167
Sequence
2452 bases(100 bases per row)
TAAATCCCTTACCAGGCCCGGCTGCATGTCCCTTCTTCCCTTGACCCATCATCCCAGCTGTGTTATCTTCAGATCCACCGGATCCATGACGTAATCATTA
TGGTGACCCTATTATGGGTACACTCATCCGGATCCAGGTCGCTTGGATCCACCTCACTGTAATTGTACACTCGCCGTGGATCCGAGCTCTTCAATCATCC
AACATCATCTTGCAACCGTCTGTGATCTCCATTGTCCCACGAAAGTTCGAGATCCACTGCATCCATCATCCCTATACCCTGGATCCAGGTCTCTCAAGGC
GGGATCCTCCTCTCCATGGATCCGAACTCGGAAGTATGGGATCCGGGGTACCTCGCGGTGGATCCTGACTTCTCGTTAACCGTGGTTACTAGATCCATCT
TCAGAGGGCACCTAATATCATTCCTTCATAGGATCCACACTCGATCCACTCTTATATAGTATATCCCATATCCATCTAAGTGGATCCAGGTAAGGGTGGA
TCCGAGATAAGTCTTGGTGGATCTTGCCTTTTCGTACATTGCTCATACCAGATCCATCGTCATTCCATACGGGGTGCTGCTCGTCATGGCTAATCCACCA
CAGGCACCTTGTACCCGTGCCAAACAACCCAAATCCTCTCTAATCACTTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAGGCCCATTCTCTTA
TTTCTGAGAAAGCACTTCACCACATGGTACGTGGAAACAAATTTGGCAGATATAGACTACGGCAGTAAATACTCAGCAAACGAAAGTAAAACAACCATCA
CTCACAACATTCTGCCGGGTACTTACTGAAGATTGTCCTACAATCAAAATTCGGTCACCTCGTGACAATGTCTGTGATGATTGTGTACTCTATCGGAATA
ACATGGGTACGAACCCAACCATTGACAAAACGGAGCCGTTAGCAAAACACGTTCAAGACGCAAGAAGTATGAGATATAAGCATACAAAGGATGGAAATAC
GGCGTCTTCCACTCATATTGTTACGACAATTGACTTTTCACAAAATATCGCAATGCCACACAGCGCTCAGACGCCATCGATGTGGTATTTTCTTAGTCTT
CTCAACATTTTAGTATTTGGAATTCATAATCAGCCGGATAATAAGCAATGGAATTACGTGTACTCTGAGCGCAAGGCCGGAAAAGGCAGCAACGAAGTTA
TCTCAATGCTGGATTGGTTTGCTCGAACCCAAATCATTTACGGAGATTGTATCGGCGACAAGTCTTAAGGTCTTTATGCTGACAATTGCGGTGAACAAAA
AAAAATTATGGTGAAGTATTTACTTTTCTTGACGCACAGTAAGGCAGTCAAATCTGTCAGCTTCAATTTTTTAATCAAGGGCCATACAAAAAATAATTGC
GATCGCGGGTTCGCGAATTTAAAGCGATACTATGCCAAACGAGATATGTGGAATTTGGATATGGTTAACGACACTATTGAGGGGTCTGCAACATCTAATA
CGTGCGTTTTGTTGGAGAACGAGGAAAACGTTTTTACAAGGTTTCAAATTTCCACTACAAAACCTCTACAAAGATTTGAAAGGGATTCAATCTTATCAAA
TTTTTACTATGGACTCTAGTGAACCTTGCAAAGTTCGATGTCAAAAGCGACAATCTAGTGCCGCGGTCGTTGTAGATCTTTTACGACGAAAAACTGATGA
GGTATTAAGCGATGGCGACATAGCTGAGTTTTGGACTTCAATTAAGACAGCCACCCCTCCCTCGTCAATGAGGAAAAAGTTGTGGACCTGCACAACAAGA
TACTGCAATATGTTTCCCCTCAATATCGTGATAACCCCCTATACTTAGTTCCTAGTGAGCAGGAAATTCTAAACAATTCGTGCCAAGAAGCGTACACGAC
GAACCAAGACTGAACAGGAATGATAAATAAATTTGCTAAAATGTGGCAATAAATATAAAACGTACATTAAAATGACTTAATTAAAAAAAAAGGAAGGATT
TGAACGCTAATCCGCAATTACGACTGTAATTTTAGGAAAGTAAACTACCTGTTGTTGCGATTTACAGAATGTTACCCTGTGAATTTGACGATTGTAAAGG
CATATTCGGAATCTATACACCAAGAGCCATCAGGACATGTACAATTAAAAAAAAAATACTTTTCGTCTAGATAGAGAGTTGATTTCTGGAAGACAGCATA
TTGGGGCTTCTAACGGCCCAAAAGAGCCATGGGAGGGCTTAAAATGAAGTCAAACATTGTAGAACATGATTGTGTACACAGTTCAATTTTCGTACTTAAG
CGTTAAGACTCATTTTGTTTGGGGCGGTCTCACTTTACAAATTTAAAGTGTTTGTGGCAAAATCTAGCCAGCGTCAAATATACATAATCGCTCTTGCTGA
TTGTTTGCTCTTTGGAAAGTAGTGAAGGTAATATGTTTGGCTTCCTTGCTGG