Description :
From Genome Similarity Track
Location :
Scaffold_253:715- 13305
Transcript NameFunction/comments
Phymu_g7562hypothetical protein PHYSODRAFT_493230
Phymu_g7563hypothetical protein PHYSODRAFT_300621

Sequence
12590 bases(100 bases per row)
ATGGCGACGCCTCCGTCGGTATCAATATCGTCACGGACGCCACCTGCGCGAGCGGTGGCGTTGGTTGCATTGACGACGTGTGTCGTTTCTGCagagccac
caccaccgtTCAGTCGGCCTCGTTCACAGACTGCGGCACCATTGCCGGCGCCGTTATCACCACAGTGACACCCACGACTGCTCCGACGGATACCCCGACT
GTAGCCCCGACCAACGCCCCCTCAAATACACCGACCGAACTTCCCACGGGGGCGCCGACTGGCGCCAACACGTGCCAGCTAGTTGCTTCTGACGGAGACG
TCCGGGTGGGCATCAACCTCGTCACAGACGCCACCTGCGCCACTGGCGGCATCGGGTGCGTCACCGATGTCTGCCGCTACTGCAGACTCGTGTACACGGA
GCAGTCGAAGGCTTTCACGGACTGTGGCACGGTTGCGGGCACGGCTGTCACCGCAGCGCCAACACAGCCACCCACCGCTGCGCCGACGGACTCCCCCACC
GTCGCACCCACCAACACCGTCGCTCCTACCAGCTCCGTCGCGCCTACCGCCGCACCGGCTTCTCAGCCGACGTGCTCTCAGGTTGTCTCGGCGGGTGACG
CATCGGTCGGCATCAACATCGTCACGGACGCCACGTGCGCGAACGGCGGTGCGGGCTGTATCGATAACATTTGTCGATTCTGCAAGGTGATCACCACGAT
CCAATCCACTGCTTTCCCGGACTGCACCTCAATCACCGGCTACTCCACGGGAGCGGTCACGACCACGGATGCACCAACGAGCGCTGTTACCACTGCTCCG
ACGGATGCCCCCACGACCGCTCCGACGGACGCCCCCACGACCGCTCCGACGGACGCCCCCACTGATGCTCCGACCGATGCTCCGACCGATGCTCCGACCG
ATGCTCCGACCGATGCTCCGACCGATGCCCCCACTGACGCCCCCACTGATGCCACTCCGACGGCCAGCGGAGCATGCACTCAGACCGCGTCGgatggtga
cgctgctgtcggtaTCAACATCTTCACGGACACGTCGTGCGCGAACGGTGGCGTGGGCTGCATTGACAACGTCTGCCGTTTCTGCAAGACGAAGTCCACG
GATCAGTCGTCGGCGTTCGTGGATTGCCCCTCAGCCTAGACTTTAACCACCAGGCCGTACGGACGGACTATCGACCTAGCTATCCTATCTAGCTAACATT
ATGAAATGCATCTCGACTAttctcttctttttttcAAGGTCGGACCATCTCAATTGCCGAGACCTTCGACCGTGCATCGAAACTGTGGTCTCGTACACCA
ACTTCTTAATTCGATCTTCCTTTAGATCTTGAAGAGACGCAGGCCCGACGAGTCCGGCATGGCGTTCCAGGCACGGCATCGCTGGATAATCCAGCGCTTG
CAGCTCGGTCTGGGATTCCAGGACGAATCgcacgtggaggagctcatgcgAGGCAACGGCATCATGGAACAGCTCACCCGGTTCTTCCGGGCGGACGGCC
CcaccaagatcttcttctactACCAGGCAAAGGGCGTGTTCccggacgacgtcatcgtctCGGGATCATCGTCTACAGCGGAACTACTACAGAGAGACAA
AAACGCAAAGAAAGAGCTGTTCGTGACGGACGGAATGGACGAGACGCTGCAAGGAcgcgccgtcttcttcgccaaagTCGTCCCCGAACCGGCAGACGCA
CGGGACGACCGGTTCGGCCTCAGTGAAGAATCAACTGCGCCTGAGACGTTAGATACGGACGAGAACTACGCATACGACACAGCTCCTCGACTGCCTTTAG
ACCCGGCAGTGGCTAACGACCACTTGCTAACGTACGGAGTACTCGACTCGTCCGTGTTGTTGTCAGTTGAAACGCACCTCTCGCAGTTGTTTATGCCTAT
GCTAACAGTGAGAGACGAGAGCGAGTGGGGACAAGCAGCTAGTGACGCGAGAAACGAGTTCATGTTGGGGTTAAAAAGCTTCGTGACGGATGTGCAGGAG
AACCTGAAGGCGATGAATACAGGTCTGGATCTACGTAAACCGGATAAAAAATACGACCCGTCGGATTCCAGAAGTTTATCCAAATTATCCACCGACGATG
GAGCAGTGCAGCACTTCGTGGAGCTGATGAAGGACTGGTGTAAGCAGACTGAGGCGTATCTGGAAGATAACGACCAAGGTCGATGGGAATCCCAAGAAGC
AGGTCCAgcgacggagctggagtATTGGAAAAGAAGACTACAGAGACTCATGGGGATAACCGAACAACTCAAGACGAAAGAGTGCAAAATGGTCACTGGC
GTTCTCAATGTGGTCTCGAAATTACAGGATGGCGTCATGGATAAACTCGGAGTTGCAACGTTACTAAGACAGTGGAAGCAGATCGACACGAATATCACAG
AGGCTTCGAATGAAGCCAAGGATAATGTCAAATATCTCGCGACACTGGAGCGCTTCATCGAGCCGTTATATACTGGTACTCCATCGTCAGTGGTAGacgc
tcttccagctctgaTGAACTCCGTCAAGATGATTCACACGATCGCTCGCTACTACAACACAACAGAGCGAATGACCAAGCTCTTCATGAAAATTACCAAC
CAGATGATCACCCTGTGCAAGAACAGCTTGGTCGGACGGGAACCTGCTGAGGCTATATGGGAGAAAGACcccgaagagcttcttctaGGTCTTGAAGCCT
GTTTAAAGCTGAACGAGGCGTATCAAGAGCAGTACCGCCTTACTAAagacaagctgctgacgaTGCCGAAAGGGAAGCAGTTTGACTTCAGTGAGACGCA
GATTTTCGGCAAGTTCGACCTATTCTGTCGCCGATTGGTTAAGCTAATCGACATGTTCAGCACGATCCACCAGTTCCGAGCGTTGGCTCAGCATTCGCTT
GAAGGGATGGATGCCTTACTGGCGTCTTTTAACACAATTATCCGGGAATTTCGCTCGCACAAGCACGACCTGCTGGATTTTCACAACAACAAATTCGACC
GGGATTATGTGGAATTTAACATTCAAATAGCAGATCTCGAGGCCTCACTGCAGCAATTTATCAACGTGAGCTTCGACTCCATCACCAGTATCGAGCAATC
GCTCCAGTTGCTCAAacagttccagcagatcctgcagCGTGAGACGTTACGCAGCGATTTAGACTCGAAATTCACGGTCATTTTCCACAATTACGGGCTG
GATTTATCTCATGTTCAGGAGCTGTACGAACGGCACCGACATGATCCTCCCGTGGCTCGAAACCTGCCTCCTGTAGCTGGCAATATCCTCTGGTCGCGTC
ATTTATTGCGTCGGATTGAAGAACCAATGCGGAAGTTTGAGAGTAACCCGACGGTTTTATCCACGAAAGATTCCAAGAAAATCATCAAGACGTACAACAA
GGTAGCACGCACTCTGGTGGCCTTCGAGTATCTCTGGTATGAAGCGTGGTGTCGTTCTGTCGAaagtgcacgagctggaCTACATGCTACTCTGATTATC
CGACATCCAGAAACTGGCAGACTTTTCGTGAATTTTGACAAAGAGATTTTACAGTTAATTCGAGAAGCTCGCTGTCTCGATCGCATGGGGATCGAAGTAC
CGGAGAACGCACGTATGGTCATGCTACAGGAGGATAAATTCAAGGCTTACTACAACGATTTAAGCTATGCGCTTCACGAATACGACCGTGTAACAGCGAA
AATCATCCCAGTTACAGCTGTTCTACTGCGTCCCCACTTGGAAGAtttgcagcagaaactgcGACCTGGACTGGTCACTCTTACGTGGACCAGTATGAAC
ATTGACGCGTATACTGCAGTAGCTCATGCGGCCTTACAacgactggaagagctcatttCCAGCGTTTTAGATGCTATCGAGAACCGCATTGAGAAGAATT
TGGTGATTGTTTCCAAGGCTTCGCTGGTGAATTTACCTACCGATCAGTCTTTTGCTCTGGATGATTTCGTACGCatgcaggagaagcacgTGGCTAACGT
TACGAGACAATTGGCAGCCAAGAATGTGGAGATTGAAAATGCAGTGGAAGATGTACTGAGGCTGATCTGTGAGTACCATCTCGATGGTTCTCCCGCAACA
GTAAACGGTGCTTCAACATTGTCAGGAACTGTAACGtgcgatgttgaagcgatGGAAACGTTCCGGAGTTTCTACCGGAATCTCTTCTACCGCTCCTTAG
TTACGTGCACCAAACAATCACTAGATGCGATCAAGAAACGCGTGTGTTCTAAGGCTGGCACCGggtttctcttcttggagcgACCGTTCTTCGAAGTGGA
CGTGCAATTATCCGTGCCTTCCGTTCGCTTAAGTCCGTCGCTGGATGATATCCAGAAAGCGATCAACCGGTCCGCTGTTGCAGTCTTACGCTGCTCGAAA
AGTCTCTATGAATGGGGACAACAGAGCGTTTATCCGGAAACGGCACGTACGAGTTTATTCGAACGCCTTGGCTGTGATACGGAGATCATTAAGGTGGCGA
TTTTACTTACTGGCGCGCTTCATGGCACGAAAAACCAAGTTCATGAGTACCTTTCAGCCTTTAAAAAGTACGATTGGCTCTGGAAAGAAGACATGGAGTT
CCGGTACAACCAGTTCATGCAGAGAAACCCGTTAATCCATGATTTCGAGACGGAATTACGCCATTTTATGGCCGTTGAAGCCGAGATTTCACTGATCGCG
CCGGTACACAACATCGCAGTGTTATCTCTCAACacgaagaacttgaagctgcagttaCGGAATGAATGTCGCCAATGGAAGGTTCAATACTCGGATAAAG
TCCATCAACAGGCTCGAACCGCACTGTTTAACTTAACGGATTACATCCGAaccacgacgtccaagcTCAGTACACGAGTGGAATCTCTCGACGCTCTTCG
ATTCGTTATGGGAGTGTTAAAAGAAGTGAGAGAGCGGGAGTCTGCGATTGAGATGGAACTCAACCCGATCGCTGATATGTACGATATGCTGGAGCATTTC
CTGCCTGGAGGCTACATGGATAAGGAGGAAATGGACCAGAAGAGTGTGCTACGTGGATCGTGGAGGAAACTCGTGGATTATGCGGAAGAAGTGACGGATA
ATCTATCCGAAGTACAAGGGGGATTCAAGAAGCAGTTAATTAAAGATGTGAAGGATTTCCAAGCGGATGTGGCAGTTTTTCGAAGCGAATACGAAGCGAT
TGGCCCGATGGTCTCGGGTCTCGAACCTGCAGAGGCTGTGGAACGTCTGAAACGATTTAAAGACCTTCTTGGGATCCGAGAGCGGAAATTAGAGGTCTTT
TCAGCTGGAGAGGAGCTTTTCGGGATGCGGCCGACCGAATATCCGGAAATTGTGCGTACTCGTAAAGAAATGGCTCTACTGGATCAGCTTTATGGACTCT
ATATGGACGTTGACAAGACAATGGACGAGTTCCGAGGTATTTCTTGGTCACAAGTGGGGGTTAATGTCGAACGGATGAGTGACTGCTTCGCTGGGTACGA
TGTGAGATGTAAGAAAATGCCCAAGAATTTATGCGAGTGGGAAGCGTACGGTATTTTACGGAAAGTTATCGCCGAGTTTCTGGAAATGCTACCAATTGTT
CGGGAATTAACCAGGGAAAGTATCAAACCGCGGCACTGGGAAGAACTCATCAAGGCTTGCAACGGCCAGCCACTGCCTTATGACAGCGAATCGTTCAAGT
TCCAGGACATTCTGGACGCGAAGCTTCTCACGTGGaaagaagacgtcgagtACATTTGCGAAAGCGCTCAAAAGCAACTGCAGATTGAGCACAAACTTCG
AGACCTGACGGATCGTTGGGCTGGCACAGCGTTCGAGTTTAGCGAGTGGAGGCAACGTAACGTGCCTGTGCTTAAAGGTTACGGCCAGATCATCGAGGAT
CTCGAAGAAGgtcagctccagctccaagccatTTTAAGTATGAGGCACGTGGTGTTTTTCAAAGACCGAGTACAAGCGAAACTCGCACAACTTTCAGACA
CGGCAGATGTGCTTGAACTGTGGGCGAAAGTGCAAACGCTGTGGATGTCACTAGAATCGGTTTTCACAGGTGGAGATATCGCCAAGCAGATGCCACTGGA
AGCGAAAAAGTTCGCGAAAATTGACAAAGATTGGCTCAAAGTCATGAGCAAAGCGTCGGAAGTCGGCTTTGTCGTGTCCTGTTGCTCTAATGAGCTACTG
CGCAGCACGCTGCCGTCTCTTTTCGGCGAACTGGAGAAATGCCAGAAGTCGTTGGAAGGATATCTCGAGCAGAAAAGGAAGAAGTTCCCTCGGTTTTACT
TCGTGTCGAACCCTCTTTTACTGCTAATTCTCTCTCGAGGATCGGATCCAACAGCTGTGCAGCAATACTACGAGAAAATCTTCGACAGTATCAGTCAAGT
AGTACACGAACGCCCAATGACTGCAGACtcgaaagctccagcagctccaacgaaCCCAAATTCCAAGCGGAAGATCGTCGAGATTAAATCTCTGGTTGGA
AATGACGAGGAAACGATCTCATTAGTTCAACCGGTTCTTCCTGATGGGAATATTGAAGATTGGCTGGGGATgttggagaaggaaatgCGACGGACACTCA
AGACTCTGTGccgtcaagctgctgctgagtgtTCGTCGGGTTCTTTGCGTGAATTCGTGAGTAAAACGTGCGCGCAGTTCGCTTTACTCGGAATTCAGTT
GAGTTGGACTACTGAATGCCAAGACGCACTGCAGAGGTGTCGAACAACTAAAGGGATTATGGCTCAGACGGCAAAGAAGCATGGCACGATGCTTTCCGAG
CTCTCTTCCTGGTGTTTAACCGATCTCGGGACGAAACTTACGCGTACGAAAGTGGAGACGTTGATTACTATCCAAGTGCACCAACGTGACTGTTTCCTGG
AGCTTTGTCGCCTctacaaggagaagaaactATCGGATGCCAATGATTTCGAATGGCTGAAACAAGCTCGATTCTATTGGCGTGTTGGAAGCCAAGGAGC
CTCCGATTCAGTGGGTCCTGATGCCTGTTTGATTTCCATTTGTGACGTGGATTTTAAGTACGCTTTCGAGTATTTAGGCTGCAAGGAACGGCTAGTGATC
ACTCCCTTGACAGATAGAGCGTACATTACTCTGTCTCAAGCGTTAGGAATGTATCTAGGTGGTGCACCCGCTGGCCCTGCAGGTACCGGTAAAACGGAGA
CGGTGAAGGACCTCGGCCGCAGTCTTGGAGTCTACGTGATCGTCACGAATTGTACCGATCAACAACGGTATTCCGACATGGCGAAGATCTTTAAAGGCCT
CTGTCAAGGCGGACTTTGGGGCTGTTTCGATGAATTTAACCGCATTGAATTACCGGTTCTGTCCGTGGTGGCACAACAAGTGTTAGCCATCACGAATGCC
AAGAGAGTGCAAGCTTCCACGTTCACATTCCCGGGCGATCCATTGCCGATAGGACTCCATACAGATTCCGCTTACTTCATCACGATGAATCCTGGATATC
AAGGACGACAGGAGTTACCTGAAAATCTTAAGGCGCTCTTCCGTGGAGTCTCTATGATGGTGCCGGATCGTGAAATTATCATGAAAGTGAGACTTTGTGC
GGTGGGATACGACGCTTTTGCCGAACTTGCGCGTAAATTCAAGACGCTGTATGCTGTTTGTGAGGGCCAATTGTCCAAACAGCGCCACTATGACTTCGGA
TTGAGGAATATCCTATCTGTACTGCGTTCCGCAGGCGCTACCAAGCGCGATAACTTACTGGCTAGTGAAGAATTGCtgctgatgacgacgttAAGGGATA
TGAATCTCTCGAAGCTTGTAGCTGCGGATGTTCCGATCTTTTTATCTCTCCTTCGGGATATTTTCCCTGGCGTGGAGCCATCACCTTCTGGAGGGACTAG
CAGTAGCGAAATCGCCGGGGCGATTGAAGATGTACTGCAAAAGGCACAAAGCTGGCCCCCTCCAGCTACTTGGAGCGCTAAAGTCACGCAATTATACGAG
ACGCAGCTTGTCCGCCATGGAATTGCGCTTGTAGGTCCCGCGGGATCTGGGAAATCCGAGATTCTACGGACGTTGCAGACGGCGTTGGGTTTTTCCACTC
GAACCCCACACAGACAAGTGCGTTTAAATCCTAAAGCGGTTCGTGCTGAAGAATTATTCGGAGAGACCGACAGATTATCCGGGGAATGGGTCGACGGGGT
GTTTGCAGCCATTTGGGCCAAGTATAACGACCGAAGCCGTAAAGATGTGGCCTGGTTGGTCTGCGACGGCCCTGTCGATGCCGTGTGGATTGAGAATTTA
AACACTGTCCTGGATGATAACAAGCTGTTAACGTTAGCCAACGGCGATCGCCTGCCCATGACGGATAACTGTAAACTCGTGTTTGAAGTCGAAGATCTAC
GAAACGCCTCACCCGCGACAGTCTCCAGGGCGGGGATTGTGTACGTGAGTGAGACGGATCTCGACTGGGAGCCTGTGGCTCAACGCTGGCTTCGTTTACG
GCCGGAAACACAGCGAACAGCTTTATCTCGCAGTCTACGGACACTGGTGGGAGGGGAAACGCCAGGTTCTGGACATTTATTTGAGTTTTTGagtcgaaga
tgccgtcCAGTGATGAATGCACCTCGTGTAGCTCTGATTCAGTCGTGCTTTAACCTCTTACAAGCTCTCGTGGATCGCAGTGAATTGAGCGAGAATATCA
GCGAtatggagctggaactggaacggTTGTTCGCTTTCGCACTGGCTTGGGCTATTGGAGGGGTATTAGATCTCGAAGACCGCGTGAAATTGCACTTTTA
TTTGGGTGAAAAGAGTCCTGCGAGTTTCCCACCGGGAACTATAGAGGCAAACGACCAAAAGACGGGGTCAAGTAGTGTAAATTTGACCATTTTCGACCAT
TTCCTGCATCCGTCGACGCTCGAATGGGAAAAATGGACACTGGATACGTGTGAAAACCTATTGACACGTACCAGTGGAGTGGTGAATGTTGGTCGTTTGA
TTATCCCCACAACGGATACTGCGCGAGCCTTGCACTTACTGGAGCACCTTCACGCCGGTCACTTACCTGTTCTACTAGTAGGTGAGCCTGGCACTGGTAA
ATCCACACTTGCACGCCTATTTTTCGAGACTGGTGGCTCTGGTTCGGAAGGAATTGCATCGCGAACATTAATTTTCGCAGGATCGACACTAGGAGGAGCT
TTCCAGGCCACAGTGGAAGGAGAATTAGAGAAACGAGGTGGAAAAACGTACGGACCTTCCAATGGCCAGCTACTGACGTTGTTTATGGACGATCTGTCCA
TGCCAGCGCTGAATGAGTGGGGAGATCAACCTACGCTTGAAGTTGTACGTCAATTGGTGGAAACTCGCACTCTCTGCTTCCTGGATAAGGACAAACGTGG
GGATATTAGGGTCATTGAAGGTTTGCGCTTCCTAGCGGCTATGGGAATCCCAAAAGCTGGGAAAAATGACGCACCGGCCCGACTTAAGCGTCATTTCTTC
GTCTTAAACCTGTTACCTGCTTCTCCCGACGTCGCAGAGTCCATTTTCGCACAATTAATGCGTTGGAAATTCGTTCCCGAGTTGGACCCcgactccagca
gctcgatgaCGGCTAAAAAGCCTATAACGGAGTTGATTTCCCGtcttgcagcttcgtcagtgCAGCTTTGGCACTGGTTACGTCGCTCGATGCCTCCTAC
GCCGCAGAAATTCCACTACGTCTTCAGTCTTCGTGAGCTCAGTCGCTGTTTCCAAGGTGTATTACGTATCCCAGTTGAAAGTATCTCGCTGAGTCCTGAT
AAAGCTCTGGTTCGACTGTGGCAGCACGAACACATGCGCGTATTTGGAGACCGACTAGTCTCATTGGAAGATAAACAACGCTTTCGGGACGAACTCACCG
CTGTGGCGGAAGGGTTAATGGTAAAGTCGAGTGGAACGGCGAGTGGCTTAATATCCAGTGGTTCAAGTAAAGAGAAACCCTCCACCGGTACGTCTGATGG
CCATAACTTACAGAATAACTTGCACCACTTCTCACGTCAAAATTCTGTACGGTCAGCTTTCAATACATGGCAAGGGCAGATTTACGTGGATTTCTTACAA
GACCAACCGCAGGACGAATTCGGAGAACCCGTAGGGGAATTACCTCGCGTGTATGAGCCTGTAGCGAGTTTATCGGCTCTTCGGGCTCGAGTTGAGCGCC
TTTTAGCTCATTTTAACCGCGAAAATCCGGCACGAGCTCTTCCCAGTCTCATCCTGTTTGAGGAAGCGTTGTCGCATTTAGCGCGACTAACGCGTGTGCT
TGGACTGGCTCAAAGTAACATGATGCTGGTCGGCGTGGGTGGATCGGGGAAGCAGTCTTTGGCTCGACTTGCAGCGGCACTTAGTGGTCATGAACTCTGC
CAGTTATCCGTCACGAAAGCATACACTCTTGCAGCTTTTCTGGACGATTTACGTGGACTATGTAAGACTGCTGGACAAGTTGGAAAAGGGGTTGTTTTCT
TACTTACCGAAGCGGATATCAAAGACGATTCGTTCCTGGAACAAGTGAACGCTCTGTTAGCTACTGGGGAAGTCCCTGGTCTCTTTCCCAGAGATGAATT
GGTCGCTATGGCGAGTGAATTACGTGGAGTCATGCAACGGGAATGTCCCGAGCGAGCGGATACGTTACCAAACCTTATTCGTTTCTTCCATGATCGAGTT
CGAAGAAATCTTCACATTGTTTTGTGTCTTTCGCCTGTAAGTTCGCGCTTTGCAGACCGTTGTCGGGAGTTCCCGCACTTAGTGAACGGCTGTACGATCG
ACTGGTTCTTACCGTGGCCGGAGGAAGCTCTTACTGCTGTAAGCCAGGGATATCTCGAGAAATTCGTACTTGAGACGCCTCCAGCTACAAAAGATGCGTT
GATACTGCAAATGGGACGAATGCACCAAgccgtggagaaggtgagCGGGGAGTATTtcacacgtcgcagacgGCGCGTTGTCCAGACGCCCCGAAGCTTT
TTGAGTTTCCTTGCGACGTACAAAGGACTTTACGGAGAGAAATTAAGCGACGTGCGACATCAGGAAGGCGCCGTGAACTTGGGGCTCCAGAAATTGGGCC
AAGGAGCGCAGGATGTGGAGAAAATGAAGGTCGTTTtaaaggaagaggaagcgaagctggtggtagcggaagcagcagccaatAAAATGCTGGAAACGCT
ACAGGTTAAGTCCCTGGAAGCCAAAAAAGAGAACGATATCGTACAGCAAATACGGGAGCAATGTCTGGCTGATGCTGCGATGATTTTAGCCGAGaaagaa
gcagccgaagagGATCTGAAACGTGCTCAGCCGTTCCTGGATGAAGCCGagagagcagcgagcagTATCCGCCCAAATGACTTGAACGAGCTAAAGAAAT
TGGCGAAACCGGGTGATATTATCAAGTTAATTTTCGATTGTGTGGCGATTCTTCAAATGGCTCCGTTGCTTAAAGTGGAGCGCACGTCTGTGACAATGGG
CGTTGGAAAGGAGAAACACACGTGCGACTTCCTTCTAGACTCGTTCCAGATCGCTAAATCTGGTATGTTAGCCGATACGAGGTTCTTACAGAACATTTTC
TACTTTTCCAAGCACCAAAAGGATCAGATGAACGATGAAACGCTGGAGTTCATGGCTCCGTATATGGATCTCGCTGGGTTTAGCGCACCAGTGGCGAAGA
ACGCGtccaaagcagcagaaggGTTATTCTGTTGGGTTAAAGCCATGAGCATGTACCATGAAGCGTCTAAAGTGGTTAAACCGAAACTGGAAGCGCTTCG
TATTGCTGAAGGGAAgtttgaagcagctcaaactCGTCTCCAGAGCTCGGAAGAGAAGCTGCAAAAGTGCCAGAACGTGCTCAACCGTTTACAGGAGGAT
TTCCAGACGCAAATGGCGGAAAAAGCACGAGTGGAAGCGTTCGCACTAGCGACAAAGCGGAAAATGGAGCAGGCAACGGCGTTAATTGGAGGACTCGGAG
GCGAAAAACTGCGCTGGACGGAAGATTCGAACCGATTCGTGGAGAGGAAGCAACATCTCGTCGGGGATTGCGCTCTGGCTGCGGCATTCTTGTGTTACTG
CGGACCTTTTAACCGCGAATATCGAGATTTACTGTTACGGGAGCGTCTTCCCTTTGAATTGGGAGCTGGAACTCCTTCTAGTAGTAGTGCTAGTCCAGTT
AAACCCCCGTATACTATTCCTCTTACTCGTGGACTCGCACTGGAGGAATTTCTGGCTGATGCGGGATCAGTTAGTGACTGGAAGTTACAGGGTTTACCGT
CAGACCCTCTATCGATTCAAAACGGGATGTTGGTGGCTAGAGCTCCTCGTTTCCCACTGCTAATAGACCCACAAGGCCAAGCTTTATCGTGGGTTCTtcg
tcgagaagctgaacgactGCCTTCTGTGGGGGTTCTTTCAGTCAGCAGCTCGAAACTTCGAGAAATTCTGGAACATTGTGTGGGTGAGGGGAAAGCTCTG
ATTCTAGATGGAGTTGACGgtgcagatccagatcctCTGATGGCAAATGTGTTGGATAAaaacttcatcgtccgagcTAAGGGGAAGTTC