Description :
From Genome Similarity Track
Location :
Scaffold_35:71491- 77179
Transcript NameFunction/comments
Physo_134960reverse transcriptase

Sequence
5688 bases(100 bases per row)
ACCTTGGTGTAGACACACCAAAGGCTATATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTCT
TAGCCAATGAGCGACATGCATAGCATTGGAATTCTGTCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAA
ACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAATTTA
AACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCACTACACCTGGTAGCACTTTGTAGTCCGTCCA
ACGACCGACTACCTGAGTTCGTACGTCACCGCACGAACACGGAGCTGAGAACCTTCCCATGGATACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGCA
ACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGATCCAGAGTGGGATGCCCTCCAACGAGATCAACAGTCATTGGTGAGGCGGCTGTAGCTACGAT
GCTGCGTACGCTAACGCCGACAGAGCAACACGGTGTTGCTCTGGGTTTCATCCTGAAGGAGCAACGCGATGTTGCTGCTACTACCGTGGTGTCGTCCGGG
ACGACACCACGCGCGCAATCGCTGAAGCTCAATGCGAGCAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACTCGGCACTGCCA
TTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACATGCAAGAAGTTGGGCGTATGGACGCCGACTCTC
GGATCCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAAGAGCTCCGACAAGCGTTTGAGCCACCGCAAAACGAGTTCCGGTCGAGAGCGGAGTTCCTC
GACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCGCGGTACTTCGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAGG
TCGTCACGTTCATGAAGGGACTGAGAGATGGGCCTGTGAAGACCTACCTCTTCCGTGAGTATCCGAGTACTCTCGAAGCTGCAATCACTCTTGCAATGCA
GGAGGAGTTTAGCCTGCGGCAGGCTAAGCTACATGCACATGCGCCGAGGCCACAGCCTCGCCCGATAGTGAGGACGGGAAGCCCAGAACCCATGGATCTC
TCGAGAGCTGCAACTGCTGGGCCCCAGCAGTCGCAAGGAAACAATGTGCGATGCTACCGATGCGGTAGAATCGGTCACTTTGCTCGGGAGTGCACGGCCC
CCGTGCACCAGCAGGGTGGCTATCGCGGCGGTTCCGGGCACCGTCGCAACCAAACAAAAACGCTGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTAATG
CAGTTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAGCCCCCAGTGAGGTTCATTCTCACTGCAAGAACCAAGATGACAAGCCTGACCTTGT
CATCCTGAACGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGG
CTTGACTTCGAGAATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCATCGTAAAGACCGAGAAGCGCATAGTACGCGTGCGCT
TCACGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCTTGGCTTGCACGGCATGA
TCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCAGAACAGTGAGCGATGGTCCTGTTGCCGCTACGCACGCACCGACAGGT
GCGCGCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCGTGAGCACGCGCGCAAGAGCAGCAAGCGTCGGCGTCGC
CGCCGACGGCTGAAGGAGAAAATGTGTTGATCTCGGAGATCGACACCCACTTTTCAGCGAATCAGGAAGAGTCTCCGACCGCAAGGGGAACGGATGACGC
AGACGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGGTCTGGCCAATAATAAGAGCCAAGGTGACGTAACGCCGTCGACTCCG
GGAGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGAGGGCTCCGCCAATAACAGGCGTCGAGGTAAAGATG
GCGTGTCGGCTCCGGAAGCCGACGCTGCAGGCGGTGCGGACGGTTGCAAACGTTCCGCACCGGAATAAACTTGCATGCTGTCGTGCAGCCGGGCTGCACG
ACGAAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATGAACCCGCCGGCGGTACTGAAGAAGAACACCCGTCCACGGCTGGGCCTGG
ACGAGGTCAAGAACCAAGCGGAGCCGGGCTCCGCAACGGCGCATGCGAAGATCGCTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTACAAGAAATGTCTA
CTGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGACGCTGAACGTCTTGACGCGTACCTGTGCCGGATTCCGGTACAGGGAGATGACTCTCGCTAACCCT
CCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCT
CGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGACCACCACTGAGAGCGAGGACACTCTCAGTGCGAAGACGAAGAA
GGAGCGCTTTGAAGAGCAGAGCTGGGACTCGTTTTCAACGAGTCCCTACTACGAGATCTTACGGGAGTACGCGGACGTACTTCCGGAAGAGATTCCTGCG
GAGCTTCCGCAGGACAAGGGAATCCAGCACGAGATTGATCTCGTGACGGGCACGAAGTACTGTGTCGCGCGGCAGTGGCCACTGCCGCTAGAGCAGGTCA
AAGCGATCGACGACTTCTTCGAAAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCTCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACA
GGGCGGCTGGCGCATCGTTCATGCGTATAACAAGCTGAACGATGCGACGATATCGGCGCAGACGCCGATACCTCGAAAAGATGTTATCATCGATTCGATG
GCCAGGAGCACTATCTACAGTGCTCTTGATCTGTGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCAGTGAGCACGCCGA
GCGACATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGA
CTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATAAGCGATGTTGAGATGCACAAGGCGCATCTCCGGAAGCTGCTT
GCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTG
TCCACCCTGACCCTGAAAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCGGTTCCTTGGCTTGGCCACGTACTTGTG
CAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGTTCCTGAAGAAGGACGCCGAGCGGAATTGGACTGTTGAGTGTCAGCAGGCCTGC
GATGCAGTGAGCAGGGCTTGACGGAGGCGCCGATCTTGGCGGTGGCCGCCCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCGACTTCACAATCGG
ATGTGCGTTGATGCAGCACGATCACGAGGGCCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTGCATGAC
AAGGAGCACCTTGCCATGAAGTACGCACTCGCGAAGTTCTGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTACACAGACCACGCGTCACTGCGGA
CGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAA
TGTGTCGGCCGACGCGCTCTCGCGTCGACCTGACTACACCACGACTGATACCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCAACGTCGTCA
CTGCGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACAAAGCTCGTCAGAAGTTGCCGAAG
CATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTTATTACTCTATAGTGCAGTCGACGACAACGCGGGCCGCGTTGTCGTGCCCAACGACC
ATGACCTGCGACTCAGGATCATGTACGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTGCTTCTCACGCGAGACTTCTA
CTGGGCCCACCAGTACAAATGGGTACGCCAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTAAAGCCTGCGCCCTTCGCGCAGGCTCCCTTGCAGTCA
CTGCCGACTCCGTCGGAGTGTTGGCAGTCCATGTCTTTGGAATTCGTGTTCGGCCTTCCCCCGGACAGCCAGGGGAACACGGGCGTTGTGGTCTTTGTTG
ACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACCATGG
CATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCGCTGCACACCTTTGGCAAGAAGTGTTTACACGTCTTGGAAGTCAACTTTCGATGTCGACT
GCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTATGCTCACTCGTTCCAACACTGGAGCGAGA
GCCTGCCGGTGGTGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCTTCCCGAG
TCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCG
ACTACGCGCAAGAAGAAGAAGAAGAACGCGTCTGTGCAGGGCACAGACGCCGACAAGAGCAAGAAGAAGAAGAAGAACGGGTCTGTGCAGGGCACAGACA
CCGCGAAGACGAACGCAGAGGCCGGATCTACTGCTAGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATCAACTTAGTTCTCAACAA