Description :
From Genome Similarity Track
Location :
Scaffold_561:7149- 9476
Transcript NameFunction/comments
Hyaar_Emoy2814326putative polyprotein

Sequence
2327 bases(100 bases per row)
TCACCGGAAGAAGTCCCGTACTGGTGATAAGGCCTAAGGCGACCGACGTAGAACGTAGGATGCGCGTGCATCTTACGTGGCAGTTCAATCGTGTATGCGT
TGCCTATGCGGCGCAGCACACGAAATGGACTGATGAACTTGGGTAGTAACAAGTTACTACCCACGTTAGTCACTATGTGTCGAGGTAAGTTTACCGTAGA
TAGTAGGACTGGATCATCTTCATTGAATGAAAGAGCATTTGCTTTTCCATTCTTATCCGCATTTTCTGTCGTCTATCCACTGCTTCTGCAATGGAATCTT
GCACGAAACGGACAACCGTTTCGCGAGCCAGTATGAATTCATCTGCTGACTCGCTGTCTTTGGCTATAGTGCGCTTGGAGCGCACTGCGGCAAGATCAGT
GACCTGGGTAGAAAGAGTACCCTCGCTCTTACTTTTCTCTTCTTCACCGAAGTCGACGTGATCGACATCGGCGTCATACGTAGTGACCTCGTGTTCAGTA
CGTGATGAGTGAGAGCCGAGCTGGCGTTCGCTCGAATGATTCCCTCCCCCCCTTAAACTAGAGTTACACCCGAAAAAGGTGGGTAGGCGTGGGTGGCGTA
AGCTATTCACGAAGAACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGTTGATGGCGAGTTCCACCGTTGGCAAGAATTCGCTCCAATTCGTAAACGA
ATGGACATAACCCCGAAGTACTTCCTCAAGAACGCGGTTTGCACGTTCTGTCTGAACATCTGTTTCAAGATGGTCAGAGGTTGACATCTGAAGGCGCGTT
CCGAGGTTTTGAACACGGATCGCCAGAATTCCGCAATGAACCGTGGGTCTCGATCAGAGACGAGTTCTCTGATCGAGACGAGTTCACGAGGCAACCCATG
AAGACGAAAGATCGTGTCAATAAAAACACGAGCACATGCCAATGCATTGATAGATCCAGGTACAGCGACCAGGTGTACCATTTTACTGAATCTATCAACG
AACACAAGAATACCTTTATTCATGTGTGGGTCTGCGGGGAATCCAAAGACAAAGTCCATTGAGACTGATTCCAAGCATTTTGCCGGAATGGGCAAGGGTT
GCAACGGCGCACGAAGTGAAGGACCTGACTTCACTCGTTGGCATACTTCGCATGCGCGGACGTACTTTCGCACGAACTGATACTGACGGGCCAGTAAAAG
TCGCGACTAACTGTGAGATATGTCTTCTCTCAACCACGATGCCCACCATTAGATGCATCGTGGTACTCATACATGATGCGCAGTCGCAGTTCACCATGGT
CCGGTTCGACGACGCGAGGCGTGTCGCCGGCAACGGCTGAATACTTCAGTAAGCCATTGTGGACTGTATATCTATCCGTGGAGGATCGATATACTGGGGG
CAACTCTTTAAGAGATTGGCGGGATGGTTGCGAGAGATGATCCATCAAGCGCACCATCGCCGGATCGTACGCCTTGCGTGTGTCTTCGAATAAGGTTGAC
GATGGGACATTCGACGTCATCACGGCGACAGTGTCGGACCATTGTCGGGTTGCGCAGCCGGTTCGAAATCGGTCCGGCGGGACAGAGCATCAGCGACAAC
ATTCAGTCGTCCTGGATTATATTCCACGGAGAAGTTATACTCCGCGAAGAACGACAGCCACCTCGCCATTCGTCGCGAGAGGTGTGGACTGTTAACGACC
GTGCGTAAGGAAGCATGGTCCGTGTAAACGATGAAGGGTCTATCACCTAGTGGGTAGACCCTGAATTTCGCCAATGCATACTTCATGGCAAGGATTTCCT
TTTCATGCACTGGGTAGTTACGTTCAGCTGGTTGCAGCTGACATGACTGATAGCAGACGACACGCTCTGCACCGTCTGTGTCGTACTGCATTAGTGCACA
TCCGATGGCAAAATAAATTGCATCGCAGACCACATGAAATGGTCTGTCTTGGTTCGCAATCGCCAAAACTGGCGAGCGTATCAAGATTTGCTTGATACCT
TCGAAGGAGCGCTGGCAATTAGCACTCCATTCCCACTTCTCGTTCTTTTTTCAACAAACGAGAGAGATGAACAGTCATCTCGGCGAAATTGTGCGAGTAT
TTGTGCAAATACGCCGCTAGACCAAGGAACTTTCGAAGTCCTTTTTTTGTCGGTAGGCACCGGGCCAGCCAGGGGATCGCCTTGATCTTTTCCGGATCCG
GGCCGGAAGCCGTACTTACCCACGATGCATCCAAGAAGTGGTATTTCGCTTGCACCAAATATACACAAATTGGAGATTGCCATACCACCTTATGCTCACG
CATCAGTGTAAGAACCTTTCGGACGTG