Description :
From Genome Similarity Track
Location :
Scaffold_50:714844- 716005
Sequence
1161 bases(100 bases per row)
CGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTCACAGACGACGCTAAACGGACTATTCGGGTCCGGTAG
CGCAAGGATCGGAGCCTGGAGAAGGCCCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTCGACGTTCCAGCACCATGGTGCGTCCTTCTTAAGGAGATCT
GATAATGGCCGAGCCATCTCTGCGTAGTTCGCGCTGTACTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCCTTTTGGTTCTTGGGAACCG
GCCAGTCCACGATGGCCTTGACTTTGGCAGGATCTGCCCTTAAGCCACGCTTCCCAATGAAGCACCCGAGGAAAGGTATTTCCTCCGCGCCAAAGACGCA
CTTATCCAAGTTGGCATACAACTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAGTGGTCAATGTGGTTTTCCACGTCTGACTTTCCGTGCTCAGCA
CGACTATGGACGAATATATCGTCAACGTACGTTTGAGCGTACGCCCGGTGGGGCCTAAACAACTGCGTCACAAGACGATTGAACGTTGCTGGTGCGTTCG
ACAGCCCCTGGGGCATCACCAGCCACTCCCAGAGCATACGGCTAGGAGTACTCACCGCTGTCAGCGGAATGTCGCTCGCTCTCATGAGCAATTGGTAGTA
GCCATCGACCAAGTCGAGCGCGCTGTACAACGTACAGCCTACCATGTTGCTCTGCAGAACATCCTTGCGAGGAATCGGCGTTTGCGCCGGGATAGTGGCC
GCATTTAGCTTGTCAAAGGCATGAACAATGCGCCACTTGCCGTTCGGCTTTCTGACACAGAACGTGGGTGTTGAGTGCGGAGACTTACTCTCACGCACCA
TCCCTGCCTCGTGCTTCGTACGGAAGAATGCGTCAATGACGTCACACTGCTCTCTCGGCAAAGGCCATTGCCTTGTTACGCAGTATTTGGTTCCAGGAAC
AGGTCAATCTCATGACACACGCCTCGATCTGGAGGCAGGCCCGTCGGTGGGTCTTTCGAGACAACGTCTCCATACTCCTTCACCACCAGCTAGAAGGGAT
CCGAAGGATCTTTGAGGATCGCCGATCCACTTCTTGCGCTCAGCGCCTTCTTGGTGTCCTC