Description :
From Genome Similarity Track
Location :
Scaffold_813:7146- 8321
Transcript NameFunction/comments
Phyag_g8173pectin lyase, putative
Phyag_g8174hypothetical protein

Sequence
1175 bases(100 bases per row)
CAAGAACACGGGTATTAGTATGTTCAACAACTACGTCCACTCCACTTCGGGTCGCTCCCCTAAGGTCGGCGACAAAAACTCTTCAGTTATCGCGCACGTC
GCCAACAACTACTGGGGTAACCACACGAACCACTCGTTCGAGCTCGATGGTAACGCGTGGATGCTCGCAGAGGGAAACTACTTCGACAATGTGAAGAGCC
CGCTCTACAAGACCGGAAAGGGTTTTCTCTACGCTGTTGACGGCACGGACGAGTGCAAGAAATACTTGGGACGAGAGTGTGAGGAGAACACTCTGGTACA
GAGTGGAAACTTCACGTCTCGTAACGGCACGGCAGCTCTCGAGGCGATGAAGCCGTACTCAGCGATTACCAACTACCCGAAGGACACTAGCGACTCAACG
GATTCGGAGCAGCAATCGTCCAGTACGAGTGACTCGACACAACAATCAACACAACTATCCTTGTCGATGGCAGGCCAGTACACTCCGGGTTCGCTAAAGT
CGTCCGAGACagagcaacaggagcagcagaggACCAAAACGAGTGACTTGAAGAAGGTTTGGGCCGAGACCACGGGCAACTTCGGCGTCGGACAGCTGGA
CTAGGTGCCCTCGGTGCTACGAGAAGCGCGACAACGAACGAAGGAATTCAGCCCGCGCATATCCAAGTCGTTCAATCGATAAACATTTCACATCCGCGTT
AAACGTTTCAAAAAAGTTGAGCCTCCAGAAAGAAACCTGATGTTCCCATCTCCAAATGCCGGTAGCATCTACTTGTCGGAGAAAATCTTCTCGCTCGAGT
CGCCAAACTTGCCATCAAAGAAGACCTCTGTCAGGTCCAGTCTCGGCGAAGGTTTCTCAGGTTTCGCCGCCGGGTTCGGGTGGCCCAGTGCAACCACCAC
AGGTATTCCGTAGCGGTCCGGGATGTCCAGCGCGTTCCTCACACGGATCTGGTCGAACCCTTCCATCGGACACGTCGCCAGACCATGCACCTGAGCAGCG
TACAGGAAAGTAGCCGCTGCAAACGTCGTCTGCTTGAACGCCCACGCTTCGGTTGACACGTTCGAAGGTGCAGGCTGTAGCGGCGACACCACCGTCGCAA
TGGCCGCACGAAGGCCGCTCGCCACCGCCCCCTCTCCAGAGAAGAGACGCACCACATGGGGCAAGTTGCTCACAA