Description :
From Genome Similarity Track
Location :
Scaffold_44:71444- 73419
Transcript NameFunction/comments
Physo_136210reverse transcriptase
Physo_136211hypothetical protein

Sequence
1975 bases(100 bases per row)
GCTGCTTCGAACGCAAGTGTTTGCCACTCCCGATAGCGGTTTGAATCCTTCCTAGCGAATCCAGGTCGACGCGGGATCTGCCCAACGGGTAACCAGATTG
CCAAACACACCAAACGATCCAGTACCAGGCGGCTCGTGCTGATGTTGGTGATCCGGAGGTACGACTTGTTACTGAATCAACCATTCACCACCGTGATCAC
CCATTTTCCCCCTCTCGTTACCCACAGTTCAAACCGCTTGTTGTGGGACTTGAGTGAGATCTCTGTCCATTGGCCAGGACCGACTTCATGGAATCCCGTT
GCGTAGACCGCGTCAGCCTTGCTGCTATACAGTGGCTTACGGTCGGTCATCTCGATGCGAACTTCGTCCGGCAGACAGAGCGCTCCGTCAGCCAGGTCCA
ACCTCAACCCCGCAGGAACCATAAAATCCATGCCGAGAATGACGTCTTGTCCTGAGAGATCTCCAACCCACACACGGAACTTGTACACCAACTCTCCAGC
CAGAGTGAGCTTGACTTCTGCTCGGCCTTCTGTGCGGTACACAGCATCCCCCAGACCAACACATTCCATTGTCTGTGTTGTATCAATTTCACAACCCACC
TTACGTGCAAAGGTAGAGTCGATTATCGACACTTCGGCTCCAGTATCACAGAGTAGGACGGCACGGACATTGTTGACCGCACCGGTCGCCTTCGACTGCT
TGAACCACTTGGAGGGAGTGTAATACTTCCAGTAACCTCGGCGTTCACCCGGCGACAGTCGAAGGGCCATCACGCGAATAGTCACCTTCATCCGAGGTAA
GAGGTCTGGCTGTATTCACCGCATTACAGGAAGTTGGGTCTTCTAACGCTCGCGCCTTCCTCTGAACATATGCATAAATGCAGAACTTCGATCGCTCGTC
ACGTACCAGGCTGTTCAGGCCTGGCGAGCGGTCTAGTTTAACGCCTTCTCGACGCTCTCGGACAGCAGTCCGGCATGGCGAGTCGGGTTGTACCATTGGC
GAACAGCATCGAAGAAGTCGCCGATCTTACACTGACCTGCTTCGTGAACGTCTCCACAGCACTTGCACACTTGTCGGTAGGATGGCCCATGTGTCCCCAC
TTCTGGCACGTGAGCCTCTTCCAGCACCCGAGATCCGTATGCTTGCGAGATCCGCAGTGTGAGCATCGAGTGCCGTACTTCGGGCGCCCCAGTTGGTCTT
CGCGGTCTTGGCGCGCCCCTGGCTGTTCACCATCTCCTGGTGTAGGCGTCCTAGCTGCCGAAAACACGTGCGCTCTTTCGTCTTCAGATTCGCTATCGGA
ACTGCTTGATTCGCCCTCAAACTCGTTGAGATCTCCGTGATCTCCGCGGCGTCCGCGACCGGTAGTCACAACCCGCACCGCCCTCGAGGAGGCTGCAGGG
GCGGGAGCCTTTTGGCGGTATTTCGAACCTTGGGTCTCAATATTGCGACGTTGGTGGCGGCGTCGCATGGCCAACAGGACGCCTTCGAGAGCTTCTGAGT
CAGGCAGCCTCAACACTACCAGATATCCGGCGAGATCGTCATCTTGGACTGTATCGATGTAGTGGTCGACGTGTTCACGTCGTTGTTCCTTGTTGCCATC
ATGGATCTTCAAGTTTGCACGTATCCCGGCCAGATTCAGCCGGTATAAGTAATCCAGTGGGTCTTCCTGACTCCCTTGCCGCATGTGGTAGTACTTGCGC
GCGAGGGAGATCCCTTTACCGCAAAAGTGGATCTAGAACTGTTCACCCAGGTCAGTCCACGACGCGCGAGCGGTGCGGCTCAGCTGGTAATACCAAATAC
GCGCAGGGCCTATCATCAAATCGGCAAATGTCAAGCACATCTCGTCTGGCTGCATCTGATCCCGTCGGAAGGCCGTTCTAACCTTGTTGAACCAGGCTCG
GGCGGCCTCTTCGTCATGTTCCTTGCCGCTGAAGTCCTTCAGTTCGGACACAGCCGACGCTCCCAACCTAGTCGC