Description :
From Genome Similarity Track
Location :
scaffold_140:7144- 9087
Sequence
1943 bases(100 bases per row)
CGTTGTTCGTACAGACCCTGTGAgtcaaagcaatcgtggATTAGCCAACGCCATTGATGCAAAATGATttgacaaaatatttttttattactaTTAATTG
TATCGCTTCTTGCGTAACTACGCGATTGCAGCACACCCATTATCAAAATTGCTGGAGAAGGACGTACAATGGAAGTGAGTATTCACTCGTGAAGAACCTT
TTACTCAAATTCAGAACAGCTTGATGGAAGCACCATTACATGCTTTACCAGATGACACGAATCTGTATAGCGTGGTGTGTGACttttttgaatttgcaaT
CGGTTCTGTACTATTGTAAAAGGACTCAGAAGAACGCGTATCGTGTCGTGTCGtttcaatcgcgacagctgaagccaGCATATTGGAGCAACcctgtcca
cgacaaggtgCTTTAGTAATGAATTATGCCTGATGAAGTTAAGTGTTAACACCTTAGCTTCAACTCCGTTTGTCGTCAAAAGGATTACTCAATCTTGCGA
TATGCAGTTCAGTCCCCTCGCTTGTCACAGCGAATGGCTCACTGGttgtcattcttcgcagGATACAACTTTACGTTTGCTTAAACACGGTCAGGACTGA
TCGTGCCGGCTGACAAACTTTCACGTCTTCCGGATTATGAACTAGCTCGAATGAGCTATATTGAAAACGATGTATTCAATATAATACGTCGAGCGTATGT
TGGGGATAAGCAGTGTGATTGCATCGCCAATGTGCTCTTGTCGAGTGATATGGAACTCCATTCCAGCTTTCCTGGTAGCTTGAAATCACAGATGCATTGT
TATGCATTGTTATGCATTGTAGAATGTATTTTTACTATGTAGTTGCATGTGGTGACGATCCACGGACGGTGGTTCCCCACAACGACTATTTGAAGCACAA
GATATTGTACGAGGCGCATGATACGCCGATGGCCGGTCACTTCAGTGCCCAATTTAGGTGGTCCgcatgtacaagtgggtTTCACGGTACGTGAAGACAG
ACGATGTCTGTCAGCGCGTGAATAGCTCACGACATGCGCAAGTGCCACTGCAGAGCCTTCCTGTTCTTACTGACTGTTGGAAGTAAGTCGGCCTCGACTT
TATTTTCGGGTCCCCTGAGAATGCAGATGGTCACAATAGAGTGCTTGTAGActtagcaagatggttcgcaTCGCTTCACGAAGCGATTCCATCGATGCCA
AAGGTTCGGCTagattgttcattgatcacgTTTCTCGCAATCACGGGTTGCCAGACGCCATTGTCTCGGATTGTGAAACACGATTAACGAGTGGCTTTTG
GACAGAATTGTTTCGATATTCTGACACTCGCTTGGATATGTCCACGAGCCGTCGGTGATGTGTTGAGAATCTTCTGTGGCAAAACTCCAGCAGAATGGAG
GTCGTTGTTACCATTGGTAGAGTTTGCTATAACAATTCGGTGCATTCATTCACGTGATTTACGCCATTTTTGAATGGCTTGCGACTTTTTGCAAGAAACG
CTTTGTGCGATCGGCGGTGCCTCTGATGTAAGTGTCTAGGTAAATTAATGCATCCCGAATTGATACAGGTAATGATGCAAATATATAGCTCAAGTAAAAA
GACGCCTTGGactcattcatcatgagtcgtatgaatgtgatcacacgtgTGTGAGATGCAATCGCGAATGCGCAAATTTTCCAAAAGAAAGACGCAGATA
GACGAGGTCGTCAAGGCAAAATGcctttgttttttttaaattatgtACTACTTAGAACTATGAACTTATCAGACGATGCGGTATCATGCTCGGGAGGCTC
GAAGCTATTACCTCGCTTCATCGGTCCATTCAGAGTAGTGTCGTGTTATGAAAATGATTATATTATTGACTGGCTATAATCGCATCTAACGTTCTACGTT
GGGCACTTCAAGCCATATCATCACGTCGACAAGACTTCCAACC