Description :
From Genome Similarity Track
Location :
contig_2:71421- 75849
Transcript NameFunction/comments
g556.t1RAW25616.1 hypothetical protein PC110_g17959 [Phytophthora cactorum
g557.t1hypothetical protein
g558.t1XP_009523153.1 hypothetical protein PHYSODRAFT_298559 [Phytophthora sojae

Sequence
4428 bases(100 bases per row)
CGTTGGAAACGGGGTTCGCCACTGGAAGCCGTGCCTAATTTGCCCTGCTGTTCACTTCATAATAGTGGCGAATCGTTTCCACCTTCTCAAGTTCACCCAG
TCGACACGCTGTATTCTGGTTGTAGCTCCAGAACAGATGAAAGCCGCCACATATCTCGAAACAGCCTTCGCTCATCTACTACAGACATCTAGGTGCGCCG
CAGTTCAAGTCTCGGTTGCTCTCCTCTACCACTCGGAGACAATCTCGGTGGAAGACAGACGGTGGAGGAGGGAGGCGATTATTAGGAGGCGCTCCACAAA
ATGGAGACAGCAGAATCATGGTTTCATGGTCTTCGAATGGTTTGCTTCAGCTTGTCATGTCAGTCCACGTCGCAGCACCGTATCAATTTTACGTCTGTTG
AGAAGAAGCACGAGTTGTTTGATCTGGCGCTGCGCTGCTAGCCGTCGACAGACGTGTGGTGTTATTAGTCATCGAGCTTAGAGCTCGTGCAAGCCCATTC
GTTATCTTTCTCCGCACACAACAAGTGGGCAGATATTATTTACCATCATGGAACCGCGCTGCCCGTTCAAAACCCCTCTCTCGCTTTCGGAGCGTGATCG
TCGGTCGATGCACAAACTGGCGCAGCGCTGCATCCACGAAACGCTGATGGACTATGAACATGTTCTAGCGAGCAAAAGCGGCCTACCCAGCGCCACCCGC
TGGAAACCCATCAGGCGAAAGGAAAACGTCGTCGTGTACCAGGATCAACTTGCAGTCGAGGAGATCAAGCGTCAGAAACGAAAAGCGAAATCGCTTGGAG
ATATCATCGAGTCGTCTCGTGTTGGTGACATTCTTTCGAGGAGCGTAGGTCCAGGGACATTTCGATCGTCCGCCACCGCATTCGCCAGAGAGACCGAGGA
GAACGACTCAAAGGAGCTGCCGAAGATGATCTGGATGGGTACCGTGGACTGCGATCTGGACGACCTCATGTACGGCCTCGTAAGCCAGAGCGACGAGGTG
ACCCGCATCAAGTCTTCCTACTCCGGCAACGGCATTCAGGACTTTGCTACGCTCGCATCCCTGGAAACGTCAACACCTAGCGACCCGTTCTACGGGCTAC
AGCTCAAGTGGGAGGTCAGTGGTTCCAAGGCAAATCCAATGTGGCGCTCCCGCGACTTCGTATACCTAGAGGCTACGGGTGTGACCAAGAGCCGTTCAAC
TGGCCAACGCATCGGGTACCAGATCCTGCACTCGCTGGATGTTCGTGGCGTGCCCGAACTGCCAGGACGCAAGTTGACTCGCGGCAAGATGACAATCTAC
CAGTTGTTCCGTCAAAAGGCCAAGGGGACCGTCGAAGTATTCGCCAAGGCGATGGTGGACTTGGCCGGAGACGTGCCTGCTAGCATGGCCTCGTTCGCTA
CCATTAAGGCGGCCAGCACCGTCAACAAGGCAGCCAAGTGCGCTCGTAAACGCAAACTCAACTGGCTGTTGGCCACGGCTGAAGCCAACTCAGTCAACTT
TGGTGTTGGCAACAACGACTCATGCTGCAGTGTGTGCGCCCAGGGACTTCGGATGCCTTTGGGCAAAAGAGCTCCTTCGAGTGCCGCATTTGCACCAAGC
GTGTGCCACAGGTGCCACATCCGACAAAAGCTCAGCTTTGTCAAGCCTGACAAGGACTCGTTCGTCATCAAGCAGAAGGCGCTCGAGCTGTGCACGCGAT
GTGTGCACACCGCCACGCAGATGAACGCTCGACGAGTGGCACTCGAAGAACGCGCACGGGAAGACCCCGCGTCCATGTATATCTACATTCCTCGCCAAAA
GAAGTCGTCACTCGAGGAGAGCTCATGCCTCGAAGAGCTCGACCTCTCAAGGGTAACGGAGAACGACGTGGAGTTCCCTCCGACACCCAAGCCTGCTCTC
TTTGATCGGGCAGCACAAGCGCTGTACTCATTCTTTTGAGTACAAGCCGCAATATCTAGAAATCCATCCGCTGTCTAGCGTCCTCATCCATCGGAAGATG
AGAAAACATGTACTTGTAATACAAGTTGTAGCTTCCCGTAAATTATATAGTACTTCAGTGCCTTTCAGCGCACACTCCTTGTTCTTCTTCAGTAACCTCC
GCAGTAGTTCGCGCTCGACGGCATGAGCGCAGGCCCAACCGCAACTCGAGCTCGCTTCAAGGTGCTGTTCTTTTGGGCAGATCGATGGCCCTGCATCAAG
ACAGCAGTCTCTTTGCTCGCGACGGACTCGACGAAGTAAAGGTACGGCTCCGTCCCGGTTTCATCCAGTCCAAGCGTGCACGCGTGCACGCGACGCGAGA
TGCCATTTCGTCGAAATCCAAGCAGGTCTGTGATGTGGCCGCCTTCCCTCACGCGAACGAGGGCACCGCCTGCAGATTCGTAGGCGCCCATTTGCGGCAC
GCTGGCCCAGATGCAACCCTCGGCATCCAGACTGATCCCGCCGAGTAGCGAGCCACATTCGCCCAGACTCGACGATTAGCCAGCTTGCCTTCCTCACCAA
CGTCGAAGGCAGTTAGTCGACCGGCCAGTGTTTCGCCCACGATCAGTGACTTGCCATCTGGAGTGATCACCATTCCGTTCGGCAGCAGCAGGTCGGTGGC
CTCCACGCGAACCTGTCTGTCCACGGGGTCGATGCTCACGAGCGTCGTCGAGCAGCAGCTCTTGATATTGGCGACGTCGAAGCCGGCATTGCTCAGATAC
ACCCGACCGGAGGCTGCGACGACCAGGTCGTTCGCTCGGAACTGCGTCACGCTCGACACGTCCGCGTACAGCTCGACGCAGCTGGATGTTTGGTCCAAGA
CCAGCACTTGTCGGTGCTTCATGCGTACAATGAGCATGCGGCCGTCGGGCAGCCACCCGATAGCCGACACGAAGTCCTCGATGTCCTCGTACACGACCCC
GACGTTTTCCGTGGCTAGGGAGTACCGCAGCACCTTCTTGCCAAACATGTCGACGAAGTACAGCGTCTGCTCTTGGCGTCGGAAGCGCGGGCTGCTCCCG
TGCATGAGGCCACTGACCAGCAGCGACGCCGCGCGCTCTTCGGTGCCGATTGGGTTCCTTGGGACCAAATGGAGTCGACGCATAGCCCATTGCCACAGAA
GCTTGCGAGGAAATACCAGCTTGAGCACGTTGGGTACCCGCCTCTTGAAGAGTTCGGGGGCGTCCTCCACCGCTTTCGTCGACGAGATGCAGCCCCAGTG
GAACACCATGGCGTAAAGGGACACTGTGGTGCGTTGCCGTGTGCAGCGCGAGGCAAGTCGGAAACTGAAGCGCTCGTCACGACAAAGTCGATGGGGGGCG
GATCATATACCACATCACAGCTTCCGAATCAGTGCGGGATCTTCCGTCCAGCGAGAGCTTGAGCGGAGACGCCACTAGACCATTAACCTTACAGAGAGAG
CGGTGCTGTGCAGCAAGTGGGTCACGACAGCAATTGGCCATCCTCGGTTCATGCATGGAGGCAACCAACACTTGCTCTCTACGACATCTGCTAGGCCTAG
AGAGTATTGGCGTATCTTTCCTGTCTGGATATTGTAATCGTCATGTGCAGTTGAAGGCGAAATACCAACGGCAAGCGGTTGTTGTCCGTGTCAAGCAGGG
CCAGATGAAAAATAGTATGCAACTAGAAGCTAGAAATCGGGGGGGGCATCATTATGATGAAGTGTTTTGGATGCGCGGAACGCGCAGTCAGTTAGACCAG
GACATCGGACGACGAAAAGAAACGCTGTATTCAGCCATGGCCCGGCAATTTACAATTGCTGGGCGGAACATGGAGAGCATGGAGGTCAAGTCGATCGTCA
AGAGTTCCGAACTCAAGCACATCCTATTAATGGAGCTTCTGGACTCCCACCTAGCAGTAGCATGCATTGCCAGGACCACCAGTTGCGAGCTGCGGTCGTG
GTGCACAGAACCAAGAAAGCAAATACTTTATTATACCTAGATACATTGTACGTTGCAGCGGTGTTCCTACGCCGCGACCACGCTCTTGAGCGGCAGCACA
GCGGCCAGCTCTTCGCAGTGGAGTTTGGCGTCGTCGTACCCCATGGCAAAACGCTCTTCGTGCGTGTTCAGGTCGACCGACAAATGGAAGGATGCTACCG
ACTGCGAGCGCCAATTCCACGGCTTGATGATGAGCCGCTTCACTTGGTTGCTCGCGTCGGAAGCTGAAGACGGGGCGATGGCGTCGTGCGGGCTCGTGAG
CATCGGCATCGAGTTGAAGACCTTGTTGGCGGCGTTCTTCCCCCACGCCCCAGGAATGAGGTACCCAGCGAGCGCGGTGGAGGCTGAGCGCGCGTAGTCC
AGCACAGTCTGCGCCGTGTGGAAGGTCAGGTCGGCCCATGTCGAGTATTCGTCACAGTCGACCCCCTTAAAGTTGGTGAAGGCGCCGTCGATGTACCACT
GGCCGCGGTGCGAGATGCACGGCTTGCC