Description :
From Genome Similarity Track
Location :
Scaffold_1165:7142- 9060
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1165-fgenesh-gene-0.3Transcription factor

Sequence
1918 bases(100 bases per row)
GTGCATATGCGGCTTACTAATGCCTGTACTCCAATGTCGGTCGGTGCTGTTGCAACAACCAGCGGGCATTTGATCAACTTTGCGAATACGAGAGTGCAAA
TCCATTTACCAAGTCGTACGTTCTCGAAGTTGGTGAATCGGTCGAGCGGCTTTTTCAGGTGCCTTTGCTGTTGTTTCTTTTAGCATCAAGGGTTGATGAT
TCCACCATCAATTTCGCCTTGCCACGCGATTCTAATGCCAAGAAAACGTACCTGTCGCGCTGCTTTCATCTGTGTAGGCGCTTGCACTGATGCTCTCGCA
TCCTGCGCATCGCGCGAACCAAATCGCGGCTGAGTCACTCCTCGAGTCATCTTTCATAACGGCGGCGAGATGAAGACGTCGCTGTGTGACTATATCAGCT
TCTCGCTTCGTGCAAGCACACAGGAGCGTTGGTGGAACAGTGAGATTGTACTCTTCGATTAAATAGATGACAGCGACCGTCAGACGTCTTTTTTTGTTGC
TTGCGGACTAAAACTAGCAAATGTCCCTTGCTTCTTTTGTCTTGCGCTTATGGACAATCGGCAAAGAAATCGGAGATGCCTTCGTTTTCGTCCAAATTGA
AACAGAAATCGGGATCCATCTACAAGAGTGCGGATTCTGACGTCAGCACGTGAACATCACGACGGACATAAGGCTGGTGGTACGTACCTTTAATGGCGCT
AATTTGAAGAGACCACTGTCGGAATCGTATGATCTCTGTTACCACATCCAGAGTGAGTAAATGGACTCTTGCTAACAGCAAAGCAGCAGAAAACTCGCGA
TAAAACTCACCTGATCCAACGCTGCAGTAGGCGGAGGCGTCTGAGTTTCCGCGGCCGGAGCAGTAGCAGCAGCTGCAGCAGGTGCGGCTTCTTTCTCTTC
CTCTTCCAACTGCCGAACTAAATACACGTCCACTGGACCATCTGTAGACTTCAAAAAAATCTGGAATCTCCGCTTCCCACTCGGCATGCCTTCGTCTGGG
TCGGGGACTTCCAGGGTCGTGCCTGGAGGAGCCTTGATCGCCATCACGCTCTGTCCTTGGAAACTCTCGAGACTGCGCATGTCTTCGTGGGTGATGAACG
ACAGATTCTCTAGCGATTCCTTATCGAACGCCTCTTCGTCGTACAGCCGTCGGATGTTCTGCGTCACCATCTTGATGTGCTGCTCGTACTTCTGCTCCTC
CTGCATCAGATCCGAGATGCTTTGCAACAAATGCTCCATGTCCTGATAATTGTCTGCCATGCCAACTGCGCTGCCACCACTGGCGCCCCTATGTATACGC
ATTCCATTCGCAAGGTAAGCATCGGCAACTAAAAGCGAAACTCGACACAATCATGACGTACTTCCAGTGGATATTGTTCTTCGATGTCTTTTCAATGAGG
CCGATGCCCTCCAAGACATTGGTGATGTCGTAAATGCGCCGTTTCTGTAGCCCATCACGTCAGCACACGCATACATTTCGTGAGTCAGTGTGCCCACCAT
AGCAAAACGAAAAGCATAAGTGAACGGGCTCGCCGTCTTGTTGGTTCTTTTCACCTGTACACCTAATGAAATCGCTGCAGAATTCAAATCGAGGTCCCCC
GACGGCGACGACTGAATCAGATCCACGAACTTCTTCGTGAGCAACCCAAGCGAACTGTCATAACGGCTCGCCGGCGACGGCTTCGACGCACTCGCTGCTT
GTTGCACAACAGTATTCATTCACATACAAAGACAAGTGCGTTAGCATAAGCCACAGCATCACTCCCCAAAATGCGGCACAGAAGAGCACTACCACACACA
CACAAAGCATACCTCGCGGACTGGGCGACTGGAATCGACTCTGGGCGCTGCTCAGCGTATTCATACTGGGCAGCCCGATCGCGGGCGAGAGCGCGCGATG
CTGTGGTGCGCTCGCAGC